FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639496_at:

>probe:Drosophila_2:1639496_at:316:305; Interrogation_Position=1024; Antisense; CCTTCAGCCTTCAGTTACCAAGAAT
>probe:Drosophila_2:1639496_at:633:555; Interrogation_Position=532; Antisense; GGACATGGACTACGACACCCGGTTG
>probe:Drosophila_2:1639496_at:605:719; Interrogation_Position=554; Antisense; TTGCTAGCGGTCAACGGAGCCATTG
>probe:Drosophila_2:1639496_at:482:553; Interrogation_Position=569; Antisense; GGAGCCATTGACCTCATCATGCGGT
>probe:Drosophila_2:1639496_at:340:181; Interrogation_Position=599; Antisense; AAAAAGGTGCTACCCGTGCTGCCCA
>probe:Drosophila_2:1639496_at:605:207; Interrogation_Position=623; Antisense; AAGCTCATTCTTCCTCTGAAACGGG
>probe:Drosophila_2:1639496_at:30:613; Interrogation_Position=639; Antisense; TGAAACGGGCCTTCCAGACGCGCGA
>probe:Drosophila_2:1639496_at:300:411; Interrogation_Position=655; Antisense; GACGCGCGACAAGCGGATCATCATC
>probe:Drosophila_2:1639496_at:268:651; Interrogation_Position=696; Antisense; TACAACTGATGGTCCGACTGGGTCC
>probe:Drosophila_2:1639496_at:67:333; Interrogation_Position=760; Antisense; GCTGGCCGTGTGCAATCTTTACAAG
>probe:Drosophila_2:1639496_at:633:325; Interrogation_Position=840; Antisense; GCGACGTCATCGAGGACACCCTGAA
>probe:Drosophila_2:1639496_at:202:621; Interrogation_Position=867; Antisense; TGCTGGAGTACTGCGGAGGCCCCAA
>probe:Drosophila_2:1639496_at:18:563; Interrogation_Position=970; Antisense; GGAAGCCTAACATTTCCCATGGAAA
>probe:Drosophila_2:1639496_at:122:393; Interrogation_Position=991; Antisense; GAAATGCCTAACTACCAGTTCGCTT

Paste this into a BLAST search page for me
CCTTCAGCCTTCAGTTACCAAGAATGGACATGGACTACGACACCCGGTTGTTGCTAGCGGTCAACGGAGCCATTGGGAGCCATTGACCTCATCATGCGGTAAAAAGGTGCTACCCGTGCTGCCCAAAGCTCATTCTTCCTCTGAAACGGGTGAAACGGGCCTTCCAGACGCGCGAGACGCGCGACAAGCGGATCATCATCTACAACTGATGGTCCGACTGGGTCCGCTGGCCGTGTGCAATCTTTACAAGGCGACGTCATCGAGGACACCCTGAATGCTGGAGTACTGCGGAGGCCCCAAGGAAGCCTAACATTTCCCATGGAAAGAAATGCCTAACTACCAGTTCGCTT

Full Affymetrix probeset data:

Annotations for 1639496_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720