Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639499_at:

>probe:Drosophila_2:1639499_at:414:455; Interrogation_Position=3511; Antisense; GATCAATACGTTTATCCCCAGCAAA
>probe:Drosophila_2:1639499_at:586:77; Interrogation_Position=3554; Antisense; AGGATGAATTGATCTCCGCTCACAT
>probe:Drosophila_2:1639499_at:454:445; Interrogation_Position=3583; Antisense; GATGCAATCCGCCAGGTGTGAGATT
>probe:Drosophila_2:1639499_at:401:517; Interrogation_Position=3598; Antisense; GTGTGAGATTTACGGCCATACCACC
>probe:Drosophila_2:1639499_at:417:563; Interrogation_Position=3703; Antisense; GGAAGCAACCTTTTTCTCATGATAT
>probe:Drosophila_2:1639499_at:85:649; Interrogation_Position=3719; Antisense; TCATGATATCCTCCTGACCAAGTCG
>probe:Drosophila_2:1639499_at:449:413; Interrogation_Position=3734; Antisense; GACCAAGTCGGGAATTTGCTCTTAT
>probe:Drosophila_2:1639499_at:126:723; Interrogation_Position=3749; Antisense; TTGCTCTTATGTTGTAATACGCTCA
>probe:Drosophila_2:1639499_at:276:345; Interrogation_Position=3809; Antisense; GCATTTTGAAGCATGGAGACACCGT
>probe:Drosophila_2:1639499_at:311:397; Interrogation_Position=3826; Antisense; GACACCGTATATGTTCAATTGCACT
>probe:Drosophila_2:1639499_at:613:247; Interrogation_Position=3842; Antisense; AATTGCACTGGACATTCGTACTGAT
>probe:Drosophila_2:1639499_at:729:255; Interrogation_Position=3931; Antisense; CAAACATCCGATGCAATTTGCTGGT
>probe:Drosophila_2:1639499_at:444:695; Interrogation_Position=3969; Antisense; TTTCCGCATCTATCGTTTTATTCAT
>probe:Drosophila_2:1639499_at:373:491; Interrogation_Position=4001; Antisense; GTACAACACATCAGTGCTTTTTGTT

Paste this into a BLAST search page for me
GATCAATACGTTTATCCCCAGCAAAAGGATGAATTGATCTCCGCTCACATGATGCAATCCGCCAGGTGTGAGATTGTGTGAGATTTACGGCCATACCACCGGAAGCAACCTTTTTCTCATGATATTCATGATATCCTCCTGACCAAGTCGGACCAAGTCGGGAATTTGCTCTTATTTGCTCTTATGTTGTAATACGCTCAGCATTTTGAAGCATGGAGACACCGTGACACCGTATATGTTCAATTGCACTAATTGCACTGGACATTCGTACTGATCAAACATCCGATGCAATTTGCTGGTTTTCCGCATCTATCGTTTTATTCATGTACAACACATCAGTGCTTTTTGTT

Full Affymetrix probeset data:

Annotations for 1639499_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime