Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639500_at:

>probe:Drosophila_2:1639500_at:412:243; Interrogation_Position=2705; Antisense; AATATTGCTGCTTAAGTGAACCGCT
>probe:Drosophila_2:1639500_at:393:221; Interrogation_Position=2718; Antisense; AAGTGAACCGCTACTCATTCGGCAT
>probe:Drosophila_2:1639500_at:428:279; Interrogation_Position=2731; Antisense; CTCATTCGGCATTCAAGTTCACTTG
>probe:Drosophila_2:1639500_at:668:473; Interrogation_Position=2747; Antisense; GTTCACTTGCTCAACAACATTTTGT
>probe:Drosophila_2:1639500_at:609:65; Interrogation_Position=2786; Antisense; ATGGTATTTATTTGCCTTGATAAGC
>probe:Drosophila_2:1639500_at:717:355; Interrogation_Position=2809; Antisense; GCAAATGAATTCGACTTCTTTATAA
>probe:Drosophila_2:1639500_at:228:89; Interrogation_Position=2833; Antisense; AGTCTTTTTGGCGTATGTGTATTAC
>probe:Drosophila_2:1639500_at:257:89; Interrogation_Position=2867; Antisense; AGTACACTCTTTGCACAATTTTCAA
>probe:Drosophila_2:1639500_at:670:493; Interrogation_Position=2893; Antisense; GTCAAAATAATGAATTCCTAGCGAA
>probe:Drosophila_2:1639500_at:139:673; Interrogation_Position=2931; Antisense; TACCACTTTCCACGTAATTACGTAT
>probe:Drosophila_2:1639500_at:276:597; Interrogation_Position=2967; Antisense; TGTAAGCATATTTATTTTTCGCGTG
>probe:Drosophila_2:1639500_at:56:703; Interrogation_Position=2982; Antisense; TTTTCGCGTGAATACTGTGATAATC
>probe:Drosophila_2:1639500_at:5:195; Interrogation_Position=3073; Antisense; AACTGTACTTTGTATGTTATGGGCT
>probe:Drosophila_2:1639500_at:71:477; Interrogation_Position=3088; Antisense; GTTATGGGCTAGTAAACTAACACAA

Paste this into a BLAST search page for me
AATATTGCTGCTTAAGTGAACCGCTAAGTGAACCGCTACTCATTCGGCATCTCATTCGGCATTCAAGTTCACTTGGTTCACTTGCTCAACAACATTTTGTATGGTATTTATTTGCCTTGATAAGCGCAAATGAATTCGACTTCTTTATAAAGTCTTTTTGGCGTATGTGTATTACAGTACACTCTTTGCACAATTTTCAAGTCAAAATAATGAATTCCTAGCGAATACCACTTTCCACGTAATTACGTATTGTAAGCATATTTATTTTTCGCGTGTTTTCGCGTGAATACTGTGATAATCAACTGTACTTTGTATGTTATGGGCTGTTATGGGCTAGTAAACTAACACAA

Full Affymetrix probeset data:

Annotations for 1639500_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime