Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639502_at:

>probe:Drosophila_2:1639502_at:552:361; Interrogation_Position=1459; Antisense; GCAATCATCAACTGTAGACCCTCAA
>probe:Drosophila_2:1639502_at:654:435; Interrogation_Position=1502; Antisense; GAGGTTCCGCACTCAAATTGCACTG
>probe:Drosophila_2:1639502_at:232:283; Interrogation_Position=1524; Antisense; CTGCCGGTTGCATGTGCTGGATTGA
>probe:Drosophila_2:1639502_at:387:547; Interrogation_Position=1557; Antisense; GGATGGGTACTTTCAATACAGCCAA
>probe:Drosophila_2:1639502_at:154:127; Interrogation_Position=1576; Antisense; AGCCAAGTGTGCCAAGATCTGTGTT
>probe:Drosophila_2:1639502_at:109:97; Interrogation_Position=1590; Antisense; AGATCTGTGTTGATCCCCAGGACAA
>probe:Drosophila_2:1639502_at:295:251; Interrogation_Position=1612; Antisense; CAAGCCGTGCCTCAATTTGGACAAT
>probe:Drosophila_2:1639502_at:473:703; Interrogation_Position=1649; Antisense; TTATCGAGTGGTCAACTGGTGTGCC
>probe:Drosophila_2:1639502_at:328:455; Interrogation_Position=1713; Antisense; GATACGTTTGTCATATTTTGCCAGA
>probe:Drosophila_2:1639502_at:272:487; Interrogation_Position=1763; Antisense; GTACGGATTCCTGACCGAACTGGAT
>probe:Drosophila_2:1639502_at:642:547; Interrogation_Position=1800; Antisense; GGATGATTATCGTAGGCTCCTGCGC
>probe:Drosophila_2:1639502_at:344:71; Interrogation_Position=1813; Antisense; AGGCTCCTGCGCTGGAATGATCATT
>probe:Drosophila_2:1639502_at:607:231; Interrogation_Position=1828; Antisense; AATGATCATTGGTGTGGCCGCCACA
>probe:Drosophila_2:1639502_at:627:217; Interrogation_Position=1865; Antisense; AAGTACTATCGACGTTCTACCTCTA

Paste this into a BLAST search page for me
GCAATCATCAACTGTAGACCCTCAAGAGGTTCCGCACTCAAATTGCACTGCTGCCGGTTGCATGTGCTGGATTGAGGATGGGTACTTTCAATACAGCCAAAGCCAAGTGTGCCAAGATCTGTGTTAGATCTGTGTTGATCCCCAGGACAACAAGCCGTGCCTCAATTTGGACAATTTATCGAGTGGTCAACTGGTGTGCCGATACGTTTGTCATATTTTGCCAGAGTACGGATTCCTGACCGAACTGGATGGATGATTATCGTAGGCTCCTGCGCAGGCTCCTGCGCTGGAATGATCATTAATGATCATTGGTGTGGCCGCCACAAAGTACTATCGACGTTCTACCTCTA

Full Affymetrix probeset data:

Annotations for 1639502_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime