Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639503_at:

>probe:Drosophila_2:1639503_at:268:693; Interrogation_Position=1938; Antisense; TTTGTTCATTTTCGGCACTTGTCAC
>probe:Drosophila_2:1639503_at:350:131; Interrogation_Position=1961; Antisense; ACCTCCTCTGCGCTATATACTTTAT
>probe:Drosophila_2:1639503_at:518:685; Interrogation_Position=2007; Antisense; TATACACACTTTACACGGAGGCACG
>probe:Drosophila_2:1639503_at:273:141; Interrogation_Position=2021; Antisense; ACGGAGGCACGTCTATCGCATTTCT
>probe:Drosophila_2:1639503_at:606:683; Interrogation_Position=2034; Antisense; TATCGCATTTCTCGCAGCCATTTTC
>probe:Drosophila_2:1639503_at:524:217; Interrogation_Position=2111; Antisense; AAGTTATCCCACGTCATTCTTATAC
>probe:Drosophila_2:1639503_at:163:183; Interrogation_Position=2216; Antisense; AAAACGAGAATGTCCAGCGTCTAGG
>probe:Drosophila_2:1639503_at:422:263; Interrogation_Position=2230; Antisense; CAGCGTCTAGGAAGTCGGCACTCAA
>probe:Drosophila_2:1639503_at:56:567; Interrogation_Position=2246; Antisense; GGCACTCAAGACTTGGCGGCACTTA
>probe:Drosophila_2:1639503_at:718:573; Interrogation_Position=2260; Antisense; GGCGGCACTTACGTTTAGGGCTATA
>probe:Drosophila_2:1639503_at:629:653; Interrogation_Position=2308; Antisense; TAATCGAACGACAACTCTCATGAGA
>probe:Drosophila_2:1639503_at:235:275; Interrogation_Position=2385; Antisense; CTTAGGGCACAATCTATTCACTTTG
>probe:Drosophila_2:1639503_at:524:13; Interrogation_Position=2400; Antisense; ATTCACTTTGTATTCGTGTGCAGTA
>probe:Drosophila_2:1639503_at:674:515; Interrogation_Position=2415; Antisense; GTGTGCAGTACTTCTCTTGTAGTTT

Paste this into a BLAST search page for me
TTTGTTCATTTTCGGCACTTGTCACACCTCCTCTGCGCTATATACTTTATTATACACACTTTACACGGAGGCACGACGGAGGCACGTCTATCGCATTTCTTATCGCATTTCTCGCAGCCATTTTCAAGTTATCCCACGTCATTCTTATACAAAACGAGAATGTCCAGCGTCTAGGCAGCGTCTAGGAAGTCGGCACTCAAGGCACTCAAGACTTGGCGGCACTTAGGCGGCACTTACGTTTAGGGCTATATAATCGAACGACAACTCTCATGAGACTTAGGGCACAATCTATTCACTTTGATTCACTTTGTATTCGTGTGCAGTAGTGTGCAGTACTTCTCTTGTAGTTT

Full Affymetrix probeset data:

Annotations for 1639503_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime