Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639504_at:

>probe:Drosophila_2:1639504_at:730:659; Interrogation_Position=1384; Antisense; TTTGCTCCAGGATCGGATGGGTCGC
>probe:Drosophila_2:1639504_at:672:151; Interrogation_Position=1439; Antisense; ACAGGAATATTTGCCGTCGCTGCTG
>probe:Drosophila_2:1639504_at:644:297; Interrogation_Position=1456; Antisense; CGCTGCTGGTCTGGTGATATCGCAA
>probe:Drosophila_2:1639504_at:293:143; Interrogation_Position=1498; Antisense; ACTGCTGCTGGTGGGTCTAACAATG
>probe:Drosophila_2:1639504_at:624:225; Interrogation_Position=1519; Antisense; AATGGCGGCCAGATTTGGAGTTTCC
>probe:Drosophila_2:1639504_at:91:473; Interrogation_Position=1538; Antisense; GTTTCCATTGCCGATGGCGCCAGTT
>probe:Drosophila_2:1639504_at:611:695; Interrogation_Position=1650; Antisense; TTTCTCCGTACATTCTTCACCTGGG
>probe:Drosophila_2:1639504_at:232:203; Interrogation_Position=1685; Antisense; AAGCCAGCTCCGTCAATCATTTTGG
>probe:Drosophila_2:1639504_at:311:15; Interrogation_Position=1703; Antisense; ATTTTGGGTCTTCTCTTCCTATCCG
>probe:Drosophila_2:1639504_at:14:685; Interrogation_Position=1722; Antisense; TATCCGGAGCCTATGTGTGCCTGCT
>probe:Drosophila_2:1639504_at:241:377; Interrogation_Position=1768; Antisense; GAAACTTCCAATGTCCTTGGCCGAA
>probe:Drosophila_2:1639504_at:371:569; Interrogation_Position=1817; Antisense; GGCATATTTGATTTTCTTCGTCATA
>probe:Drosophila_2:1639504_at:66:169; Interrogation_Position=1875; Antisense; AAATGGGTCCCACGATTGTTGAGGA
>probe:Drosophila_2:1639504_at:594:557; Interrogation_Position=1900; Antisense; GGACACTCTGATTAATAAGCCGGTT

Paste this into a BLAST search page for me
TTTGCTCCAGGATCGGATGGGTCGCACAGGAATATTTGCCGTCGCTGCTGCGCTGCTGGTCTGGTGATATCGCAAACTGCTGCTGGTGGGTCTAACAATGAATGGCGGCCAGATTTGGAGTTTCCGTTTCCATTGCCGATGGCGCCAGTTTTTCTCCGTACATTCTTCACCTGGGAAGCCAGCTCCGTCAATCATTTTGGATTTTGGGTCTTCTCTTCCTATCCGTATCCGGAGCCTATGTGTGCCTGCTGAAACTTCCAATGTCCTTGGCCGAAGGCATATTTGATTTTCTTCGTCATAAAATGGGTCCCACGATTGTTGAGGAGGACACTCTGATTAATAAGCCGGTT

Full Affymetrix probeset data:

Annotations for 1639504_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime