FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639507_at:

>probe:Drosophila_2:1639507_at:568:261; Interrogation_Position=131; Antisense; CAGCCGCCCGGTATCGATGAAGGTG
>probe:Drosophila_2:1639507_at:92:43; Interrogation_Position=143; Antisense; ATCGATGAAGGTGGTTTCCGTGGCC
>probe:Drosophila_2:1639507_at:641:391; Interrogation_Position=168; Antisense; GAAACCCAGAAGGACGAGTCGTTCT
>probe:Drosophila_2:1639507_at:76:529; Interrogation_Position=323; Antisense; GGGATTGGGCGCTCTGATCTCGTCC
>probe:Drosophila_2:1639507_at:351:503; Interrogation_Position=344; Antisense; GTCCCACGACATTAGCCACTATGTG
>probe:Drosophila_2:1639507_at:718:59; Interrogation_Position=364; Antisense; ATGTGACCATGGTGGAGGGCCTCCA
>probe:Drosophila_2:1639507_at:339:653; Interrogation_Position=415; Antisense; TCAAGTTTATCATCGCCTATCCGGC
>probe:Drosophila_2:1639507_at:89:333; Interrogation_Position=438; Antisense; GCTGGCTATCACACCGCCAATGGTA
>probe:Drosophila_2:1639507_at:266:299; Interrogation_Position=452; Antisense; CGCCAATGGTATTAGGCATCTCCTC
>probe:Drosophila_2:1639507_at:57:397; Interrogation_Position=480; Antisense; GACACCGGACGGTTCCTGAAGATCA
>probe:Drosophila_2:1639507_at:318:699; Interrogation_Position=511; Antisense; TTTACTCCACCGGTTACGCAATGGT
>probe:Drosophila_2:1639507_at:577:641; Interrogation_Position=543; Antisense; TCTTTCGTGCTATCCGCTATCTTGG
>probe:Drosophila_2:1639507_at:479:683; Interrogation_Position=560; Antisense; TATCTTGGCCCTGCTCTAAGTCCAA
>probe:Drosophila_2:1639507_at:584:411; Interrogation_Position=585; Antisense; GACCCCAGCTAAACCTATTACATTT

Paste this into a BLAST search page for me
CAGCCGCCCGGTATCGATGAAGGTGATCGATGAAGGTGGTTTCCGTGGCCGAAACCCAGAAGGACGAGTCGTTCTGGGATTGGGCGCTCTGATCTCGTCCGTCCCACGACATTAGCCACTATGTGATGTGACCATGGTGGAGGGCCTCCATCAAGTTTATCATCGCCTATCCGGCGCTGGCTATCACACCGCCAATGGTACGCCAATGGTATTAGGCATCTCCTCGACACCGGACGGTTCCTGAAGATCATTTACTCCACCGGTTACGCAATGGTTCTTTCGTGCTATCCGCTATCTTGGTATCTTGGCCCTGCTCTAAGTCCAAGACCCCAGCTAAACCTATTACATTT

Full Affymetrix probeset data:

Annotations for 1639507_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720