Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639509_at:

>probe:Drosophila_2:1639509_at:34:97; Interrogation_Position=2317; Antisense; AGATAACACATCCACAATAGGCATG
>probe:Drosophila_2:1639509_at:563:25; Interrogation_Position=2333; Antisense; ATAGGCATGTCTTATGCTGGTTTTA
>probe:Drosophila_2:1639509_at:429:333; Interrogation_Position=2348; Antisense; GCTGGTTTTATAATACGTCTATACA
>probe:Drosophila_2:1639509_at:567:495; Interrogation_Position=2364; Antisense; GTCTATACACACGAAAGTTTCCATG
>probe:Drosophila_2:1639509_at:352:217; Interrogation_Position=2378; Antisense; AAGTTTCCATGCTATATTTTTCTAT
>probe:Drosophila_2:1639509_at:555:321; Interrogation_Position=2417; Antisense; GCCCTTTTGTTTAGTTTCGAGAGCA
>probe:Drosophila_2:1639509_at:509:637; Interrogation_Position=2433; Antisense; TCGAGAGCACCGTTACTATGCTTAA
>probe:Drosophila_2:1639509_at:345:17; Interrogation_Position=2485; Antisense; ATTTACGATAGTTCCGTGTTGCCTT
>probe:Drosophila_2:1639509_at:698:513; Interrogation_Position=2500; Antisense; GTGTTGCCTTGACTAATTTCTACTC
>probe:Drosophila_2:1639509_at:570:489; Interrogation_Position=2547; Antisense; GTACTAAATGTAATCCCCTAATCTT
>probe:Drosophila_2:1639509_at:529:183; Interrogation_Position=2594; Antisense; AAAATACTATTGCTTGTAGGCCATT
>probe:Drosophila_2:1639509_at:317:723; Interrogation_Position=2607; Antisense; TTGTAGGCCATTTTATGTTCAAGCT
>probe:Drosophila_2:1639509_at:569:601; Interrogation_Position=2622; Antisense; TGTTCAAGCTATCCTCTGATCTGAG
>probe:Drosophila_2:1639509_at:455:441; Interrogation_Position=2745; Antisense; GATGGGCTAACAATTCCAGCTTTCA

Paste this into a BLAST search page for me
AGATAACACATCCACAATAGGCATGATAGGCATGTCTTATGCTGGTTTTAGCTGGTTTTATAATACGTCTATACAGTCTATACACACGAAAGTTTCCATGAAGTTTCCATGCTATATTTTTCTATGCCCTTTTGTTTAGTTTCGAGAGCATCGAGAGCACCGTTACTATGCTTAAATTTACGATAGTTCCGTGTTGCCTTGTGTTGCCTTGACTAATTTCTACTCGTACTAAATGTAATCCCCTAATCTTAAAATACTATTGCTTGTAGGCCATTTTGTAGGCCATTTTATGTTCAAGCTTGTTCAAGCTATCCTCTGATCTGAGGATGGGCTAACAATTCCAGCTTTCA

Full Affymetrix probeset data:

Annotations for 1639509_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime