FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639513_at:

>probe:Drosophila_2:1639513_at:110:33; Interrogation_Position=1270; Antisense; ATAAGGCCAGGCGTGATGCCATCAC
>probe:Drosophila_2:1639513_at:593:73; Interrogation_Position=1300; Antisense; AGGACATGGACGGTGGCACCTTCAC
>probe:Drosophila_2:1639513_at:315:227; Interrogation_Position=1332; Antisense; AATGGCGGAGTGTTCGGATCCCTGA
>probe:Drosophila_2:1639513_at:656:99; Interrogation_Position=1384; Antisense; AGAGTGCCATTCTCGGCATGCACGG
>probe:Drosophila_2:1639513_at:118:55; Interrogation_Position=1401; Antisense; ATGCACGGCATCTTTGAGCGGCCAA
>probe:Drosophila_2:1639513_at:310:609; Interrogation_Position=1415; Antisense; TGAGCGGCCAATTGCTGTCAAGGGA
>probe:Drosophila_2:1639513_at:226:455; Interrogation_Position=1448; Antisense; GATACGTCCTATGATGTACATCGCC
>probe:Drosophila_2:1639513_at:71:611; Interrogation_Position=1474; Antisense; TGACCTACGATCACCGAATCATTGA
>probe:Drosophila_2:1639513_at:690:225; Interrogation_Position=1533; Antisense; AAGGCTGCCGTAGAGAACCCAGCAA
>probe:Drosophila_2:1639513_at:156:3; Interrogation_Position=1583; Antisense; ATTGTCTTAAGACACGTCCACGGCC
>probe:Drosophila_2:1639513_at:653:137; Interrogation_Position=1596; Antisense; ACGTCCACGGCCTTAATTTGATATT
>probe:Drosophila_2:1639513_at:460:689; Interrogation_Position=1654; Antisense; TATTATTTCATTTTGCGAGCGTCAC
>probe:Drosophila_2:1639513_at:87:363; Interrogation_Position=1698; Antisense; GAATTCGAACTACTCTTAGCAACGG
>probe:Drosophila_2:1639513_at:719:3; Interrogation_Position=1783; Antisense; ATTGTTAACCTAAGACGCTGCGATG

Paste this into a BLAST search page for me
ATAAGGCCAGGCGTGATGCCATCACAGGACATGGACGGTGGCACCTTCACAATGGCGGAGTGTTCGGATCCCTGAAGAGTGCCATTCTCGGCATGCACGGATGCACGGCATCTTTGAGCGGCCAATGAGCGGCCAATTGCTGTCAAGGGAGATACGTCCTATGATGTACATCGCCTGACCTACGATCACCGAATCATTGAAAGGCTGCCGTAGAGAACCCAGCAAATTGTCTTAAGACACGTCCACGGCCACGTCCACGGCCTTAATTTGATATTTATTATTTCATTTTGCGAGCGTCACGAATTCGAACTACTCTTAGCAACGGATTGTTAACCTAAGACGCTGCGATG

Full Affymetrix probeset data:

Annotations for 1639513_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720