FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639514_at:

>probe:Drosophila_2:1639514_at:576:225; Interrogation_Position=1012; Antisense; AAGGACGGCATCCACAATCCGCTGA
>probe:Drosophila_2:1639514_at:522:235; Interrogation_Position=1027; Antisense; AATCCGCTGACATGGCAGGCGCAGG
>probe:Drosophila_2:1639514_at:692:267; Interrogation_Position=1048; Antisense; CAGGAGGCGCAAGTCCAGGAGTTTA
>probe:Drosophila_2:1639514_at:33:353; Interrogation_Position=1116; Antisense; GCAGCGTAACATGCTCGACTGGATA
>probe:Drosophila_2:1639514_at:408:7; Interrogation_Position=1146; Antisense; ATTGCATTATCACTCGTACGACACG
>probe:Drosophila_2:1639514_at:230:53; Interrogation_Position=716; Antisense; AGAAAAGCTTTCTGGATCCTTCGTC
>probe:Drosophila_2:1639514_at:38:629; Interrogation_Position=739; Antisense; TCCAAGCGCTTCATCATGTCCTTTA
>probe:Drosophila_2:1639514_at:720:597; Interrogation_Position=755; Antisense; TGTCCTTTACGAGCAGCGAGCCATT
>probe:Drosophila_2:1639514_at:646:429; Interrogation_Position=783; Antisense; GAGTCCCCAGGACATCGAATTTGTC
>probe:Drosophila_2:1639514_at:667:633; Interrogation_Position=819; Antisense; TAAGGGTCAGAGCTTTATGCTGCAC
>probe:Drosophila_2:1639514_at:145:683; Interrogation_Position=834; Antisense; TATGCTGCACCAGATTCGCAAGATG
>probe:Drosophila_2:1639514_at:109:519; Interrogation_Position=859; Antisense; GTGGGTCTAGCCATTGCCATTGTAA
>probe:Drosophila_2:1639514_at:39:587; Interrogation_Position=971; Antisense; TGGACACAGTGCACTACGAGCGCTA
>probe:Drosophila_2:1639514_at:112:665; Interrogation_Position=994; Antisense; TACAACGATCGCTACGGCAAGGACG

Paste this into a BLAST search page for me
AAGGACGGCATCCACAATCCGCTGAAATCCGCTGACATGGCAGGCGCAGGCAGGAGGCGCAAGTCCAGGAGTTTAGCAGCGTAACATGCTCGACTGGATAATTGCATTATCACTCGTACGACACGAGAAAAGCTTTCTGGATCCTTCGTCTCCAAGCGCTTCATCATGTCCTTTATGTCCTTTACGAGCAGCGAGCCATTGAGTCCCCAGGACATCGAATTTGTCTAAGGGTCAGAGCTTTATGCTGCACTATGCTGCACCAGATTCGCAAGATGGTGGGTCTAGCCATTGCCATTGTAATGGACACAGTGCACTACGAGCGCTATACAACGATCGCTACGGCAAGGACG

Full Affymetrix probeset data:

Annotations for 1639514_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720