FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639515_at:

>probe:Drosophila_2:1639515_at:473:87; Interrogation_Position=1055; Antisense; AGTCTATTAACTCGCCCAAAGGATT
>probe:Drosophila_2:1639515_at:477:73; Interrogation_Position=1074; Antisense; AGGATTTTACGGTGTTCCCTGCTCT
>probe:Drosophila_2:1639515_at:135:307; Interrogation_Position=1091; Antisense; CCTGCTCTGGACTGGATGAACTCAA
>probe:Drosophila_2:1639515_at:122:379; Interrogation_Position=1168; Antisense; GAAGCTCGCGGAATATTCTTTGTGA
>probe:Drosophila_2:1639515_at:454:151; Interrogation_Position=1202; Antisense; ACAAACCGAGCTACGCCTTGGGTAT
>probe:Drosophila_2:1639515_at:121:49; Interrogation_Position=664; Antisense; ATCCATCTGATTGGCCACAGTCTGG
>probe:Drosophila_2:1639515_at:717:593; Interrogation_Position=701; Antisense; TGGGCTATGCTGGTTCGTACACTAA
>probe:Drosophila_2:1639515_at:301:537; Interrogation_Position=732; Antisense; GGTAAACCGCATCACTGGCTTGGAT
>probe:Drosophila_2:1639515_at:291:301; Interrogation_Position=766; Antisense; CCCGCTTTCGAGGATTGCATTGGTC
>probe:Drosophila_2:1639515_at:639:421; Interrogation_Position=793; Antisense; GAGAATCACTTGGACGACACGGACG
>probe:Drosophila_2:1639515_at:728:397; Interrogation_Position=808; Antisense; GACACGGACGCCAACTTTGTGGATG
>probe:Drosophila_2:1639515_at:125:443; Interrogation_Position=829; Antisense; GATGTCATACACAGCTGTGCCGGAT
>probe:Drosophila_2:1639515_at:641:299; Interrogation_Position=871; Antisense; CCCATCGGCATGGTGGATTTCTATC
>probe:Drosophila_2:1639515_at:627:17; Interrogation_Position=887; Antisense; ATTTCTATCCCAATGGCGGTGGACC

Paste this into a BLAST search page for me
AGTCTATTAACTCGCCCAAAGGATTAGGATTTTACGGTGTTCCCTGCTCTCCTGCTCTGGACTGGATGAACTCAAGAAGCTCGCGGAATATTCTTTGTGAACAAACCGAGCTACGCCTTGGGTATATCCATCTGATTGGCCACAGTCTGGTGGGCTATGCTGGTTCGTACACTAAGGTAAACCGCATCACTGGCTTGGATCCCGCTTTCGAGGATTGCATTGGTCGAGAATCACTTGGACGACACGGACGGACACGGACGCCAACTTTGTGGATGGATGTCATACACAGCTGTGCCGGATCCCATCGGCATGGTGGATTTCTATCATTTCTATCCCAATGGCGGTGGACC

Full Affymetrix probeset data:

Annotations for 1639515_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720