FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639516_at:

>probe:Drosophila_2:1639516_at:1:681; Interrogation_Position=1004; Antisense; TATGATATCAGTGTGGCCCTTGGAA
>probe:Drosophila_2:1639516_at:610:583; Interrogation_Position=1024; Antisense; TGGAAACCCCTACCAATGCTCAGGT
>probe:Drosophila_2:1639516_at:289:239; Interrogation_Position=1073; Antisense; AATCAACTGTGCGTCGAACATCCGT
>probe:Drosophila_2:1639516_at:119:151; Interrogation_Position=1090; Antisense; ACATCCGTACGGAATGGGCTTCATT
>probe:Drosophila_2:1639516_at:252:523; Interrogation_Position=1105; Antisense; GGGCTTCATTGGGAGCTACATACTG
>probe:Drosophila_2:1639516_at:222:539; Interrogation_Position=1175; Antisense; GGTATCGTCAGTGATTCTTCAAATG
>probe:Drosophila_2:1639516_at:518:95; Interrogation_Position=1274; Antisense; AGATCAACTCGATATGCGCTAGCCG
>probe:Drosophila_2:1639516_at:19:325; Interrogation_Position=1289; Antisense; GCGCTAGCCGAACATATAATCCATT
>probe:Drosophila_2:1639516_at:555:637; Interrogation_Position=816; Antisense; TCGAGGATGAACCACAGTCTGCACC
>probe:Drosophila_2:1639516_at:720:87; Interrogation_Position=831; Antisense; AGTCTGCACCCTTCTACAAAATTAT
>probe:Drosophila_2:1639516_at:403:725; Interrogation_Position=878; Antisense; TTGTACAACGACTGTGGCGGCGCCA
>probe:Drosophila_2:1639516_at:142:289; Interrogation_Position=895; Antisense; CGGCGCCAACATTGCTGCGAATTTG
>probe:Drosophila_2:1639516_at:174:549; Interrogation_Position=919; Antisense; GGAGGCACTTATTCTAGACCAACAG
>probe:Drosophila_2:1639516_at:506:57; Interrogation_Position=971; Antisense; ATGTTCTTCGAAGCTCCCGATAATG

Paste this into a BLAST search page for me
TATGATATCAGTGTGGCCCTTGGAATGGAAACCCCTACCAATGCTCAGGTAATCAACTGTGCGTCGAACATCCGTACATCCGTACGGAATGGGCTTCATTGGGCTTCATTGGGAGCTACATACTGGGTATCGTCAGTGATTCTTCAAATGAGATCAACTCGATATGCGCTAGCCGGCGCTAGCCGAACATATAATCCATTTCGAGGATGAACCACAGTCTGCACCAGTCTGCACCCTTCTACAAAATTATTTGTACAACGACTGTGGCGGCGCCACGGCGCCAACATTGCTGCGAATTTGGGAGGCACTTATTCTAGACCAACAGATGTTCTTCGAAGCTCCCGATAATG

Full Affymetrix probeset data:

Annotations for 1639516_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720