FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639519_at:

>probe:Drosophila_2:1639519_at:475:575; Interrogation_Position=2185; Antisense; GGCGACGCCGCGATCGAGAGTACAT
>probe:Drosophila_2:1639519_at:513:425; Interrogation_Position=2200; Antisense; GAGAGTACATCACCTAGACGCGCTG
>probe:Drosophila_2:1639519_at:352:707; Interrogation_Position=2228; Antisense; TTAAAGCCCCTTATCAGTTATATGC
>probe:Drosophila_2:1639519_at:318:633; Interrogation_Position=2274; Antisense; TCCCCATCCCATATCTTGATTTGTG
>probe:Drosophila_2:1639519_at:90:175; Interrogation_Position=2319; Antisense; AAACGAACACTTTCTAGCGGCCCAT
>probe:Drosophila_2:1639519_at:380:595; Interrogation_Position=2362; Antisense; TGTGGCCTTAGTTTTCATAGCGAAA
>probe:Drosophila_2:1639519_at:622:97; Interrogation_Position=2399; Antisense; AGATCGCCATTCACTGTAATCGCTG
>probe:Drosophila_2:1639519_at:212:221; Interrogation_Position=2441; Antisense; AAGTGAATCCACACATCCCTTAGCA
>probe:Drosophila_2:1639519_at:163:601; Interrogation_Position=2529; Antisense; TGTTTGTGAACAGACCTTCCCGAAA
>probe:Drosophila_2:1639519_at:489:17; Interrogation_Position=2558; Antisense; ATTTTTACTCTATACATCCCTGCTA
>probe:Drosophila_2:1639519_at:269:679; Interrogation_Position=2581; Antisense; TAGGTGACCCCGCATAGTTATGTAG
>probe:Drosophila_2:1639519_at:673:79; Interrogation_Position=2604; Antisense; AGGTCTCCAACTTTTTGTGTGGCGA
>probe:Drosophila_2:1639519_at:102:179; Interrogation_Position=2646; Antisense; AAACATGCCTGAACCGATTGTGAAT
>probe:Drosophila_2:1639519_at:676:3; Interrogation_Position=2662; Antisense; ATTGTGAATTTTGTGACTGCCGCCG

Paste this into a BLAST search page for me
GGCGACGCCGCGATCGAGAGTACATGAGAGTACATCACCTAGACGCGCTGTTAAAGCCCCTTATCAGTTATATGCTCCCCATCCCATATCTTGATTTGTGAAACGAACACTTTCTAGCGGCCCATTGTGGCCTTAGTTTTCATAGCGAAAAGATCGCCATTCACTGTAATCGCTGAAGTGAATCCACACATCCCTTAGCATGTTTGTGAACAGACCTTCCCGAAAATTTTTACTCTATACATCCCTGCTATAGGTGACCCCGCATAGTTATGTAGAGGTCTCCAACTTTTTGTGTGGCGAAAACATGCCTGAACCGATTGTGAATATTGTGAATTTTGTGACTGCCGCCG

Full Affymetrix probeset data:

Annotations for 1639519_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720