FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639520_at:

>probe:Drosophila_2:1639520_at:182:535; Interrogation_Position=450; Antisense; GGTGCTCCTGCTGGCGATAGGATCA
>probe:Drosophila_2:1639520_at:663:35; Interrogation_Position=471; Antisense; ATCATGCCAGGTTGTGGGCTCTGTT
>probe:Drosophila_2:1639520_at:728:459; Interrogation_Position=493; Antisense; GTTTTCGGGTTTATTGCTGTGGTCA
>probe:Drosophila_2:1639520_at:225:703; Interrogation_Position=519; Antisense; TTTTGGCGCCAAAGGAGATTCTCGG
>probe:Drosophila_2:1639520_at:699:95; Interrogation_Position=534; Antisense; AGATTCTCGGGATTGGATGCCAGGA
>probe:Drosophila_2:1639520_at:203:605; Interrogation_Position=570; Antisense; TGATATGGGCTGGTCATTTGCTCTG
>probe:Drosophila_2:1639520_at:600:289; Interrogation_Position=623; Antisense; CGTCTGGCGTACTCTATCTAGTAGA
>probe:Drosophila_2:1639520_at:637:479; Interrogation_Position=717; Antisense; GTATTACCAGAATCAGGGACCCTCC
>probe:Drosophila_2:1639520_at:558:629; Interrogation_Position=759; Antisense; TCCATCGCCATATCAATCCTATTTT
>probe:Drosophila_2:1639520_at:657:687; Interrogation_Position=778; Antisense; TATTTTGCATCTGAGCCAAGCCGAC
>probe:Drosophila_2:1639520_at:501:371; Interrogation_Position=806; Antisense; GAAGACCCCAACAAAGTAGTGCATC
>probe:Drosophila_2:1639520_at:686:485; Interrogation_Position=821; Antisense; GTAGTGCATCGAATTCCGCTGTACA
>probe:Drosophila_2:1639520_at:286:565; Interrogation_Position=889; Antisense; GGAATTATCCGTCCATTTACACAAT
>probe:Drosophila_2:1639520_at:627:497; Interrogation_Position=965; Antisense; GTCATTCCACTAAATCCACTACAAA

Paste this into a BLAST search page for me
GGTGCTCCTGCTGGCGATAGGATCAATCATGCCAGGTTGTGGGCTCTGTTGTTTTCGGGTTTATTGCTGTGGTCATTTTGGCGCCAAAGGAGATTCTCGGAGATTCTCGGGATTGGATGCCAGGATGATATGGGCTGGTCATTTGCTCTGCGTCTGGCGTACTCTATCTAGTAGAGTATTACCAGAATCAGGGACCCTCCTCCATCGCCATATCAATCCTATTTTTATTTTGCATCTGAGCCAAGCCGACGAAGACCCCAACAAAGTAGTGCATCGTAGTGCATCGAATTCCGCTGTACAGGAATTATCCGTCCATTTACACAATGTCATTCCACTAAATCCACTACAAA

Full Affymetrix probeset data:

Annotations for 1639520_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720