FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639522_at:

>probe:Drosophila_2:1639522_at:706:381; Interrogation_Position=111; Antisense; GAACGATGCCAGTTTGACGCCGGGA
>probe:Drosophila_2:1639522_at:654:691; Interrogation_Position=123; Antisense; TTTGACGCCGGGACGCAGGAAGCTC
>probe:Drosophila_2:1639522_at:458:627; Interrogation_Position=146; Antisense; TCCAGAAGTGGCTGGGTCGAGTTCT
>probe:Drosophila_2:1639522_at:166:537; Interrogation_Position=160; Antisense; GGTCGAGTTCTTCGGATCGTGATTA
>probe:Drosophila_2:1639522_at:562:637; Interrogation_Position=176; Antisense; TCGTGATTACGGACGGACGCGTGCT
>probe:Drosophila_2:1639522_at:585:107; Interrogation_Position=18; Antisense; AGAACTGAGCATCACTGGCCAGCAG
>probe:Drosophila_2:1639522_at:467:409; Interrogation_Position=191; Antisense; GACGCGTGCTGGTGGGATTCTTCAA
>probe:Drosophila_2:1639522_at:278:593; Interrogation_Position=203; Antisense; TGGGATTCTTCAACTGCACGGACCG
>probe:Drosophila_2:1639522_at:530:133; Interrogation_Position=230; Antisense; ACGCCAACATCGTGCTGTCCATGTG
>probe:Drosophila_2:1639522_at:62:309; Interrogation_Position=248; Antisense; CCATGTGCGCCGAGTACTTGGTGGA
>probe:Drosophila_2:1639522_at:298:619; Interrogation_Position=290; Antisense; TGCTGGGCAACGTCATGGTTCCCGG
>probe:Drosophila_2:1639522_at:41:113; Interrogation_Position=317; Antisense; AGCACATAGTCTCCCTAAGCATCGA
>probe:Drosophila_2:1639522_at:280:209; Interrogation_Position=333; Antisense; AAGCATCGACGAGCCGGATCCGCAG
>probe:Drosophila_2:1639522_at:345:201; Interrogation_Position=94; Antisense; AACGCCCCGCACCAGATGAACGATG

Paste this into a BLAST search page for me
GAACGATGCCAGTTTGACGCCGGGATTTGACGCCGGGACGCAGGAAGCTCTCCAGAAGTGGCTGGGTCGAGTTCTGGTCGAGTTCTTCGGATCGTGATTATCGTGATTACGGACGGACGCGTGCTAGAACTGAGCATCACTGGCCAGCAGGACGCGTGCTGGTGGGATTCTTCAATGGGATTCTTCAACTGCACGGACCGACGCCAACATCGTGCTGTCCATGTGCCATGTGCGCCGAGTACTTGGTGGATGCTGGGCAACGTCATGGTTCCCGGAGCACATAGTCTCCCTAAGCATCGAAAGCATCGACGAGCCGGATCCGCAGAACGCCCCGCACCAGATGAACGATG

Full Affymetrix probeset data:

Annotations for 1639522_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720