FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639525_at:

>probe:Drosophila_2:1639525_at:557:89; Interrogation_Position=1283; Antisense; AGTAATGCAGTTCGGCCGCACCTCG
>probe:Drosophila_2:1639525_at:500:547; Interrogation_Position=1307; Antisense; GGAGGACGTCTTCACCATGGACTAT
>probe:Drosophila_2:1639525_at:40:315; Interrogation_Position=1362; Antisense; GCCATTGCCCTCAGTAGTTTCGATG
>probe:Drosophila_2:1639525_at:463:321; Interrogation_Position=1429; Antisense; GCCCGTTGCCTTATGTACAGCTGAT
>probe:Drosophila_2:1639525_at:268:263; Interrogation_Position=1446; Antisense; CAGCTGATTATCTGGAGTGCGGATC
>probe:Drosophila_2:1639525_at:67:337; Interrogation_Position=1476; Antisense; GCTCCGGGCGGATCATTGTTGAAAT
>probe:Drosophila_2:1639525_at:116:165; Interrogation_Position=1510; Antisense; AAATCTAGTCACTCGAAGTCGGGTT
>probe:Drosophila_2:1639525_at:653:89; Interrogation_Position=1569; Antisense; AGTAGCTACTCGTATCGCGTATCAT
>probe:Drosophila_2:1639525_at:44:229; Interrogation_Position=1612; Antisense; AATGTGCTCACCGATTTTATAAGAA
>probe:Drosophila_2:1639525_at:637:583; Interrogation_Position=1643; Antisense; TAGGACAGGTCCTACAACTTTGTAA
>probe:Drosophila_2:1639525_at:98:167; Interrogation_Position=1672; Antisense; AAATGTGCCCCTTTTAGCGATAAGT
>probe:Drosophila_2:1639525_at:188:207; Interrogation_Position=1705; Antisense; AAGCGATTCGAAGTCAAGGTCATTT
>probe:Drosophila_2:1639525_at:216:167; Interrogation_Position=1793; Antisense; AAATGCCACTACTATTAGTCGGTAA
>probe:Drosophila_2:1639525_at:716:423; Interrogation_Position=1818; Antisense; GAGAGCACTACTAACTTGTACTAAG

Paste this into a BLAST search page for me
AGTAATGCAGTTCGGCCGCACCTCGGGAGGACGTCTTCACCATGGACTATGCCATTGCCCTCAGTAGTTTCGATGGCCCGTTGCCTTATGTACAGCTGATCAGCTGATTATCTGGAGTGCGGATCGCTCCGGGCGGATCATTGTTGAAATAAATCTAGTCACTCGAAGTCGGGTTAGTAGCTACTCGTATCGCGTATCATAATGTGCTCACCGATTTTATAAGAATAGGACAGGTCCTACAACTTTGTAAAAATGTGCCCCTTTTAGCGATAAGTAAGCGATTCGAAGTCAAGGTCATTTAAATGCCACTACTATTAGTCGGTAAGAGAGCACTACTAACTTGTACTAAG

Full Affymetrix probeset data:

Annotations for 1639525_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720