FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639530_at:

>probe:Drosophila_2:1639530_at:724:465; Interrogation_Position=1525; Antisense; GTTGAAGTACGCCACTCTAGGCTAT
>probe:Drosophila_2:1639530_at:116:447; Interrogation_Position=1564; Antisense; GATGCTACACGGCTTCGACGATGAT
>probe:Drosophila_2:1639530_at:619:223; Interrogation_Position=1591; Antisense; AAGGCAGTACGATGCGTCCGGTAAC
>probe:Drosophila_2:1639530_at:80:583; Interrogation_Position=1617; Antisense; TGGCGCCTTGGTGGGACTTGAAATC
>probe:Drosophila_2:1639530_at:85:723; Interrogation_Position=1634; Antisense; TTGAAATCCCGCTACGAGTTTGAGG
>probe:Drosophila_2:1639530_at:61:345; Interrogation_Position=1671; Antisense; GCTTCCAAGCCCAGTATCACGAGTA
>probe:Drosophila_2:1639530_at:544:491; Interrogation_Position=1827; Antisense; GTGAAACCATGGAGGGTCTGCCCTT
>probe:Drosophila_2:1639530_at:639:115; Interrogation_Position=1863; Antisense; AGCTTTTCTTCTTGGGATACGCACA
>probe:Drosophila_2:1639530_at:613:507; Interrogation_Position=1894; Antisense; GTGCGACGACGTTCAGTTTCTCTTC
>probe:Drosophila_2:1639530_at:294:261; Interrogation_Position=1919; Antisense; CAGCCCTGGGTGAGTCAATCGGACA
>probe:Drosophila_2:1639530_at:228:555; Interrogation_Position=1973; Antisense; GGACCGCTGTCCAATTTTCAGGAGT
>probe:Drosophila_2:1639530_at:77:73; Interrogation_Position=1992; Antisense; AGGAGTTCCCTTGGGTCTTCAACTG
>probe:Drosophila_2:1639530_at:558:237; Interrogation_Position=2022; Antisense; AATCGGCGCCCATGGATCCGGAGTA
>probe:Drosophila_2:1639530_at:335:47; Interrogation_Position=2037; Antisense; ATCCGGAGTACAAGTGCGCCATCTA

Paste this into a BLAST search page for me
GTTGAAGTACGCCACTCTAGGCTATGATGCTACACGGCTTCGACGATGATAAGGCAGTACGATGCGTCCGGTAACTGGCGCCTTGGTGGGACTTGAAATCTTGAAATCCCGCTACGAGTTTGAGGGCTTCCAAGCCCAGTATCACGAGTAGTGAAACCATGGAGGGTCTGCCCTTAGCTTTTCTTCTTGGGATACGCACAGTGCGACGACGTTCAGTTTCTCTTCCAGCCCTGGGTGAGTCAATCGGACAGGACCGCTGTCCAATTTTCAGGAGTAGGAGTTCCCTTGGGTCTTCAACTGAATCGGCGCCCATGGATCCGGAGTAATCCGGAGTACAAGTGCGCCATCTA

Full Affymetrix probeset data:

Annotations for 1639530_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720