FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639532_at:

>probe:Drosophila_2:1639532_at:7:169; Interrogation_Position=185; Antisense; AAATGATCCTGCTGAGCTGCGGTTT
>probe:Drosophila_2:1639532_at:715:573; Interrogation_Position=210; Antisense; GGCTGTGCTCTTGGGCTTCTCAGAA
>probe:Drosophila_2:1639532_at:661:105; Interrogation_Position=231; Antisense; AGAAGCCCTACCTCGATACAGTCGA
>probe:Drosophila_2:1639532_at:248:73; Interrogation_Position=314; Antisense; AGGAACCGATGACCCTCACTGGGAA
>probe:Drosophila_2:1639532_at:248:651; Interrogation_Position=329; Antisense; TCACTGGGAACTACAACCTCATCAT
>probe:Drosophila_2:1639532_at:376:671; Interrogation_Position=415; Antisense; TACGATGCCCAAATGAGTCCCGACT
>probe:Drosophila_2:1639532_at:713:431; Interrogation_Position=429; Antisense; GAGTCCCGACTCTGATCTCGGAATG
>probe:Drosophila_2:1639532_at:641:367; Interrogation_Position=457; Antisense; GAATCGCAGTTTTTGAGCCACACTC
>probe:Drosophila_2:1639532_at:511:391; Interrogation_Position=516; Antisense; GAAACGTGCTCGTCAGCAGATTCCC
>probe:Drosophila_2:1639532_at:706:375; Interrogation_Position=561; Antisense; GAAGAAGGCCCTGCTCAAGCTAAAG
>probe:Drosophila_2:1639532_at:458:433; Interrogation_Position=622; Antisense; GAGTGGGACCAGTTCGACTACGATT
>probe:Drosophila_2:1639532_at:206:137; Interrogation_Position=641; Antisense; ACGATTTGTACAGCCTGAATCCCGG
>probe:Drosophila_2:1639532_at:545:47; Interrogation_Position=689; Antisense; ATGCCTAGATGGATTCGGTTCCCTA
>probe:Drosophila_2:1639532_at:583:541; Interrogation_Position=705; Antisense; GGTTCCCTACTAAATCGACTGTATA

Paste this into a BLAST search page for me
AAATGATCCTGCTGAGCTGCGGTTTGGCTGTGCTCTTGGGCTTCTCAGAAAGAAGCCCTACCTCGATACAGTCGAAGGAACCGATGACCCTCACTGGGAATCACTGGGAACTACAACCTCATCATTACGATGCCCAAATGAGTCCCGACTGAGTCCCGACTCTGATCTCGGAATGGAATCGCAGTTTTTGAGCCACACTCGAAACGTGCTCGTCAGCAGATTCCCGAAGAAGGCCCTGCTCAAGCTAAAGGAGTGGGACCAGTTCGACTACGATTACGATTTGTACAGCCTGAATCCCGGATGCCTAGATGGATTCGGTTCCCTAGGTTCCCTACTAAATCGACTGTATA

Full Affymetrix probeset data:

Annotations for 1639532_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720