Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639534_at:

>probe:Drosophila_2:1639534_at:192:369; Interrogation_Position=1422; Antisense; GAATGTTAATCCTGACAAGCGACTG
>probe:Drosophila_2:1639534_at:262:119; Interrogation_Position=1439; Antisense; AGCGACTGAAAACACTACTGCCCAA
>probe:Drosophila_2:1639534_at:556:185; Interrogation_Position=1449; Antisense; AACACTACTGCCCAAGGAGACTGTA
>probe:Drosophila_2:1639534_at:282:671; Interrogation_Position=1496; Antisense; TACCCCATTCATAACTTCTCAGAGA
>probe:Drosophila_2:1639534_at:108:231; Interrogation_Position=1619; Antisense; AATGAGACGTGGGATCTCTCGTTCT
>probe:Drosophila_2:1639534_at:432:545; Interrogation_Position=1630; Antisense; GGATCTCTCGTTCTGAGTTCTAGTA
>probe:Drosophila_2:1639534_at:168:363; Interrogation_Position=1672; Antisense; GAATATTCACGGAAACCCAGTTTCT
>probe:Drosophila_2:1639534_at:346:465; Interrogation_Position=1736; Antisense; GATTGATTTGCTACCAACGAATTGT
>probe:Drosophila_2:1639534_at:4:483; Interrogation_Position=1771; Antisense; GTATATTGTGGCAGGTTCTTGAAAC
>probe:Drosophila_2:1639534_at:51:469; Interrogation_Position=1802; Antisense; GTTGAGGCCGTTCTATCTTATCTAA
>probe:Drosophila_2:1639534_at:228:529; Interrogation_Position=1830; Antisense; GGTGACTACGATCTATTGCGTCGTT
>probe:Drosophila_2:1639534_at:115:381; Interrogation_Position=1871; Antisense; GAACGAATACCTGCCAAATGACTAA
>probe:Drosophila_2:1639534_at:336:475; Interrogation_Position=1907; Antisense; GTTAGCACCTTATCAACGCCAGAAG
>probe:Drosophila_2:1639534_at:292:393; Interrogation_Position=1995; Antisense; GAAAGCTTTTCGCTATTCAGAAATA

Paste this into a BLAST search page for me
GAATGTTAATCCTGACAAGCGACTGAGCGACTGAAAACACTACTGCCCAAAACACTACTGCCCAAGGAGACTGTATACCCCATTCATAACTTCTCAGAGAAATGAGACGTGGGATCTCTCGTTCTGGATCTCTCGTTCTGAGTTCTAGTAGAATATTCACGGAAACCCAGTTTCTGATTGATTTGCTACCAACGAATTGTGTATATTGTGGCAGGTTCTTGAAACGTTGAGGCCGTTCTATCTTATCTAAGGTGACTACGATCTATTGCGTCGTTGAACGAATACCTGCCAAATGACTAAGTTAGCACCTTATCAACGCCAGAAGGAAAGCTTTTCGCTATTCAGAAATA

Full Affymetrix probeset data:

Annotations for 1639534_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime