Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639535_at:

>probe:Drosophila_2:1639535_at:375:91; Interrogation_Position=1961; Antisense; AGTATCCACATATGGTCCGTTTCAG
>probe:Drosophila_2:1639535_at:242:149; Interrogation_Position=1968; Antisense; ACATATGGTCCGTTTCAGAAAATCT
>probe:Drosophila_2:1639535_at:708:387; Interrogation_Position=1985; Antisense; GAAAATCTAGATACCCAAGCTCAGA
>probe:Drosophila_2:1639535_at:641:27; Interrogation_Position=1995; Antisense; ATACCCAAGCTCAGAGTCTTCTCAA
>probe:Drosophila_2:1639535_at:728:429; Interrogation_Position=2008; Antisense; GAGTCTTCTCAACCTTGTACTTAAA
>probe:Drosophila_2:1639535_at:527:703; Interrogation_Position=2145; Antisense; TTATTTGAATGTTTATCGAAGGCCA
>probe:Drosophila_2:1639535_at:703:245; Interrogation_Position=2230; Antisense; AATTGGATTGTCTCTGGTGTTTCAC
>probe:Drosophila_2:1639535_at:379:499; Interrogation_Position=2239; Antisense; GTCTCTGGTGTTTCACAATCAATTG
>probe:Drosophila_2:1639535_at:127:249; Interrogation_Position=2258; Antisense; CAATTGGTTATTATTTCGAATGCAT
>probe:Drosophila_2:1639535_at:333:177; Interrogation_Position=2307; Antisense; AAACTTGCTTGCTTTTTATCACAGA
>probe:Drosophila_2:1639535_at:91:701; Interrogation_Position=2322; Antisense; TTATCACAGACACACAACCGAATTG
>probe:Drosophila_2:1639535_at:48:617; Interrogation_Position=2345; Antisense; TGAATTGTGAGCATATTTTTTCCAA
>probe:Drosophila_2:1639535_at:403:11; Interrogation_Position=2373; Antisense; ATTCTCTTAATTAAAATGGCTGGCA
>probe:Drosophila_2:1639535_at:58:575; Interrogation_Position=2390; Antisense; GGCTGGCAAAAGTGGCAAATGATTT

Paste this into a BLAST search page for me
AGTATCCACATATGGTCCGTTTCAGACATATGGTCCGTTTCAGAAAATCTGAAAATCTAGATACCCAAGCTCAGAATACCCAAGCTCAGAGTCTTCTCAAGAGTCTTCTCAACCTTGTACTTAAATTATTTGAATGTTTATCGAAGGCCAAATTGGATTGTCTCTGGTGTTTCACGTCTCTGGTGTTTCACAATCAATTGCAATTGGTTATTATTTCGAATGCATAAACTTGCTTGCTTTTTATCACAGATTATCACAGACACACAACCGAATTGTGAATTGTGAGCATATTTTTTCCAAATTCTCTTAATTAAAATGGCTGGCAGGCTGGCAAAAGTGGCAAATGATTT

Full Affymetrix probeset data:

Annotations for 1639535_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime