FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639536_at:

>probe:Drosophila_2:1639536_at:99:705; Interrogation_Position=2438; Antisense; TTAGGATTCGCGCTGGACGACAACA
>probe:Drosophila_2:1639536_at:232:507; Interrogation_Position=2471; Antisense; GTGCCCGGCGGCATAATGATGTTCT
>probe:Drosophila_2:1639536_at:194:249; Interrogation_Position=2506; Antisense; CAATAATTATGTATCCGCCCACTCG
>probe:Drosophila_2:1639536_at:306:281; Interrogation_Position=2535; Antisense; CTCGTGGTCAGCTGTACTACTTTAA
>probe:Drosophila_2:1639536_at:111:397; Interrogation_Position=2593; Antisense; GATACCCAGGAATAAGGCCGACGAG
>probe:Drosophila_2:1639536_at:125:97; Interrogation_Position=2616; Antisense; AGATCTTCGCCTCGTTTCGGTTTAG
>probe:Drosophila_2:1639536_at:604:315; Interrogation_Position=2652; Antisense; GCCTGCTCTGGAAGTGGACGGACCT
>probe:Drosophila_2:1639536_at:395:559; Interrogation_Position=2704; Antisense; GGACAATCCAAAGATCCTGTTCCGC
>probe:Drosophila_2:1639536_at:534:325; Interrogation_Position=2730; Antisense; GCGACTTTGTCAAGTTCATTGCGGA
>probe:Drosophila_2:1639536_at:636:3; Interrogation_Position=2747; Antisense; ATTGCGGACAAGTTGGGCCACAGCT
>probe:Drosophila_2:1639536_at:365:355; Interrogation_Position=2866; Antisense; GCACGCCTAGGATTCATCGGGAAGT
>probe:Drosophila_2:1639536_at:602:373; Interrogation_Position=2886; Antisense; GAAGTTTTACAACGGATCCCTGCAT
>probe:Drosophila_2:1639536_at:545:545; Interrogation_Position=2899; Antisense; GGATCCCTGCATTTTACTTATTCGA
>probe:Drosophila_2:1639536_at:21:483; Interrogation_Position=2929; Antisense; GTATTCGACGATCCGCATGACCTAA

Paste this into a BLAST search page for me
TTAGGATTCGCGCTGGACGACAACAGTGCCCGGCGGCATAATGATGTTCTCAATAATTATGTATCCGCCCACTCGCTCGTGGTCAGCTGTACTACTTTAAGATACCCAGGAATAAGGCCGACGAGAGATCTTCGCCTCGTTTCGGTTTAGGCCTGCTCTGGAAGTGGACGGACCTGGACAATCCAAAGATCCTGTTCCGCGCGACTTTGTCAAGTTCATTGCGGAATTGCGGACAAGTTGGGCCACAGCTGCACGCCTAGGATTCATCGGGAAGTGAAGTTTTACAACGGATCCCTGCATGGATCCCTGCATTTTACTTATTCGAGTATTCGACGATCCGCATGACCTAA

Full Affymetrix probeset data:

Annotations for 1639536_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720