FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639537_at:

>probe:Drosophila_2:1639537_at:271:547; Interrogation_Position=2847; Antisense; GGATGAATTTTTCACCACAGCCGAC
>probe:Drosophila_2:1639537_at:104:317; Interrogation_Position=2892; Antisense; GCCTAGACAGCATAAACCTCACGTT
>probe:Drosophila_2:1639537_at:5:413; Interrogation_Position=2918; Antisense; GACCGAGATTTTCACCAGATCCTCA
>probe:Drosophila_2:1639537_at:642:543; Interrogation_Position=2970; Antisense; GGATCTCTATATGCTTCAACCGGAG
>probe:Drosophila_2:1639537_at:200:533; Interrogation_Position=3007; Antisense; GGTGGTCAAAACAATCCGCTTAAGG
>probe:Drosophila_2:1639537_at:60:203; Interrogation_Position=3034; Antisense; AAGCTAACCAACTGTCATGTGTCTG
>probe:Drosophila_2:1639537_at:320:415; Interrogation_Position=3064; Antisense; GAGCGTCCTTTCAGCGTTCAAAAGA
>probe:Drosophila_2:1639537_at:248:449; Interrogation_Position=3105; Antisense; GATCCTGTTGGTTGTAGACACCTTG
>probe:Drosophila_2:1639537_at:618:727; Interrogation_Position=3127; Antisense; TTGTGTCCATGTGGCTCCAAGCAAC
>probe:Drosophila_2:1639537_at:701:235; Interrogation_Position=3183; Antisense; AATCGGAGCCTGCAGTACGAGACGC
>probe:Drosophila_2:1639537_at:653:219; Interrogation_Position=3244; Antisense; AAGTGCATCAACTATCATCCCGAGG
>probe:Drosophila_2:1639537_at:526:89; Interrogation_Position=3298; Antisense; AGTACTCTGCTGCACATGTCGGGAT
>probe:Drosophila_2:1639537_at:354:501; Interrogation_Position=3315; Antisense; GTCGGGATCGGTAATTGTGGCACAT
>probe:Drosophila_2:1639537_at:194:65; Interrogation_Position=3346; Antisense; ATGGTGACCGTGACCTTTGTGCTGG

Paste this into a BLAST search page for me
GGATGAATTTTTCACCACAGCCGACGCCTAGACAGCATAAACCTCACGTTGACCGAGATTTTCACCAGATCCTCAGGATCTCTATATGCTTCAACCGGAGGGTGGTCAAAACAATCCGCTTAAGGAAGCTAACCAACTGTCATGTGTCTGGAGCGTCCTTTCAGCGTTCAAAAGAGATCCTGTTGGTTGTAGACACCTTGTTGTGTCCATGTGGCTCCAAGCAACAATCGGAGCCTGCAGTACGAGACGCAAGTGCATCAACTATCATCCCGAGGAGTACTCTGCTGCACATGTCGGGATGTCGGGATCGGTAATTGTGGCACATATGGTGACCGTGACCTTTGTGCTGG

Full Affymetrix probeset data:

Annotations for 1639537_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720