FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639539_at:

>probe:Drosophila_2:1639539_at:301:307; Interrogation_Position=1172; Antisense; CCTTTCATTGGTCGCTTTACTGAGA
>probe:Drosophila_2:1639539_at:243:557; Interrogation_Position=1233; Antisense; GGACTACCTTGAACTTGGGCCTTCT
>probe:Drosophila_2:1639539_at:433:723; Interrogation_Position=1247; Antisense; TTGGGCCTTCTTATGTTGGGATACA
>probe:Drosophila_2:1639539_at:240:413; Interrogation_Position=1274; Antisense; GACCGTGTTTTTAAGGATCCTCACA
>probe:Drosophila_2:1639539_at:213:585; Interrogation_Position=1317; Antisense; TCGACCGTGAGAAACCAGGGCCGTT
>probe:Drosophila_2:1639539_at:86:431; Interrogation_Position=1343; Antisense; GAGTACGTGCCCTTTAGTGCTGGTC
>probe:Drosophila_2:1639539_at:710:635; Interrogation_Position=1432; Antisense; TCGAAATTTCGAGGTGCTGCCAGCT
>probe:Drosophila_2:1639539_at:320:659; Interrogation_Position=1488; Antisense; TAAGCACAACTCTAGGTCTTCAGCC
>probe:Drosophila_2:1639539_at:41:417; Interrogation_Position=1525; Antisense; GAGCCGTGATGCTCACAACCATAAG
>probe:Drosophila_2:1639539_at:72:449; Interrogation_Position=1553; Antisense; GATCCAATTTTGTCGGCATCCATGA
>probe:Drosophila_2:1639539_at:485:387; Interrogation_Position=1589; Antisense; GAAAATGGTCTACATCTACGCATGA
>probe:Drosophila_2:1639539_at:167:187; Interrogation_Position=1646; Antisense; AACACTTGCATGCTTATGGGCTACG
>probe:Drosophila_2:1639539_at:507:63; Interrogation_Position=1661; Antisense; ATGGGCTACGACTTTGCAAACTTTG
>probe:Drosophila_2:1639539_at:175:35; Interrogation_Position=1716; Antisense; ATCAGCGCTACTTTATTGTCACTTA

Paste this into a BLAST search page for me
CCTTTCATTGGTCGCTTTACTGAGAGGACTACCTTGAACTTGGGCCTTCTTTGGGCCTTCTTATGTTGGGATACAGACCGTGTTTTTAAGGATCCTCACATCGACCGTGAGAAACCAGGGCCGTTGAGTACGTGCCCTTTAGTGCTGGTCTCGAAATTTCGAGGTGCTGCCAGCTTAAGCACAACTCTAGGTCTTCAGCCGAGCCGTGATGCTCACAACCATAAGGATCCAATTTTGTCGGCATCCATGAGAAAATGGTCTACATCTACGCATGAAACACTTGCATGCTTATGGGCTACGATGGGCTACGACTTTGCAAACTTTGATCAGCGCTACTTTATTGTCACTTA

Full Affymetrix probeset data:

Annotations for 1639539_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720