Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639542_at:

>probe:Drosophila_2:1639542_at:434:397; Interrogation_Position=3795; Antisense; GACAAGTTTTATTTTTGCGCCAAAG
>probe:Drosophila_2:1639542_at:271:17; Interrogation_Position=3805; Antisense; ATTTTTGCGCCAAAGCGATGCAGAT
>probe:Drosophila_2:1639542_at:432:469; Interrogation_Position=3837; Antisense; GTTCCTTGATTGACTCACATTGAGT
>probe:Drosophila_2:1639542_at:280:259; Interrogation_Position=3852; Antisense; CACATTGAGTCGTTTATTGAAGCTA
>probe:Drosophila_2:1639542_at:100:601; Interrogation_Position=3918; Antisense; TGTAGCACACTAAATTTCCCCACAG
>probe:Drosophila_2:1639542_at:360:163; Interrogation_Position=3929; Antisense; AAATTTCCCCACAGCTATGTTCAAA
>probe:Drosophila_2:1639542_at:13:465; Interrogation_Position=3964; Antisense; GTTGGTTCCCTAAATTTCAGAGTGC
>probe:Drosophila_2:1639542_at:378:453; Interrogation_Position=3990; Antisense; GATAACGTATCTCTATTTTTGCTTT
>probe:Drosophila_2:1639542_at:452:635; Interrogation_Position=4054; Antisense; TCGCGTAAGCTTATGATATGGCCCA
>probe:Drosophila_2:1639542_at:620:457; Interrogation_Position=4068; Antisense; GATATGGCCCAACCAGCGAGACTGA
>probe:Drosophila_2:1639542_at:630:405; Interrogation_Position=4087; Antisense; GACTGACCGTTTATGATTGTCTAAA
>probe:Drosophila_2:1639542_at:452:297; Interrogation_Position=4218; Antisense; CGAACTGACATAGTCGATCATGTTA
>probe:Drosophila_2:1639542_at:240:477; Interrogation_Position=4279; Antisense; GTTTTACTAACCGACACAGTTGCTT
>probe:Drosophila_2:1639542_at:616:397; Interrogation_Position=4291; Antisense; GACACAGTTGCTTGGATTCCCATTG

Paste this into a BLAST search page for me
GACAAGTTTTATTTTTGCGCCAAAGATTTTTGCGCCAAAGCGATGCAGATGTTCCTTGATTGACTCACATTGAGTCACATTGAGTCGTTTATTGAAGCTATGTAGCACACTAAATTTCCCCACAGAAATTTCCCCACAGCTATGTTCAAAGTTGGTTCCCTAAATTTCAGAGTGCGATAACGTATCTCTATTTTTGCTTTTCGCGTAAGCTTATGATATGGCCCAGATATGGCCCAACCAGCGAGACTGAGACTGACCGTTTATGATTGTCTAAACGAACTGACATAGTCGATCATGTTAGTTTTACTAACCGACACAGTTGCTTGACACAGTTGCTTGGATTCCCATTG

Full Affymetrix probeset data:

Annotations for 1639542_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime