Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639544_at:

>probe:Drosophila_2:1639544_at:168:261; Interrogation_Position=1089; Antisense; CACCGTGGTGGGACAACTGCTGAAG
>probe:Drosophila_2:1639544_at:246:377; Interrogation_Position=1110; Antisense; GAAGCAGTTTGCTCCCGACATGGAT
>probe:Drosophila_2:1639544_at:575:153; Interrogation_Position=1127; Antisense; ACATGGATGTCCAGCCACTGTTGGC
>probe:Drosophila_2:1639544_at:715:593; Interrogation_Position=1154; Antisense; TGGGCAGCGATGTGACGCTCAGCTC
>probe:Drosophila_2:1639544_at:211:293; Interrogation_Position=1308; Antisense; CGATGCCATGACACTCAGAGTCTGA
>probe:Drosophila_2:1639544_at:616:607; Interrogation_Position=1330; Antisense; TGAGCGAACGCATCCGAGTGCTTCT
>probe:Drosophila_2:1639544_at:501:501; Interrogation_Position=1362; Antisense; GTCGCCTGCTTGTTTCAGGGTTCAA
>probe:Drosophila_2:1639544_at:122:531; Interrogation_Position=1379; Antisense; GGGTTCAAGTGCAAGTTCCTAGCTG
>probe:Drosophila_2:1639544_at:142:95; Interrogation_Position=1392; Antisense; AGTTCCTAGCTGTGTTGCTTCACAA
>probe:Drosophila_2:1639544_at:161:683; Interrogation_Position=1430; Antisense; TATCGTGTGGGCTCTCAAATGACTC
>probe:Drosophila_2:1639544_at:666:343; Interrogation_Position=1465; Antisense; GCTTCGTCGTCATTACGCGGACAAC
>probe:Drosophila_2:1639544_at:273:291; Interrogation_Position=1490; Antisense; CGTCCACAGTGATTTTCCGCTAAAG
>probe:Drosophila_2:1639544_at:118:323; Interrogation_Position=1530; Antisense; GCGCCGCATAGATAGACACGTACGT
>probe:Drosophila_2:1639544_at:317:105; Interrogation_Position=1543; Antisense; AGACACGTACGTTCGTTCAGTGATA

Paste this into a BLAST search page for me
CACCGTGGTGGGACAACTGCTGAAGGAAGCAGTTTGCTCCCGACATGGATACATGGATGTCCAGCCACTGTTGGCTGGGCAGCGATGTGACGCTCAGCTCCGATGCCATGACACTCAGAGTCTGATGAGCGAACGCATCCGAGTGCTTCTGTCGCCTGCTTGTTTCAGGGTTCAAGGGTTCAAGTGCAAGTTCCTAGCTGAGTTCCTAGCTGTGTTGCTTCACAATATCGTGTGGGCTCTCAAATGACTCGCTTCGTCGTCATTACGCGGACAACCGTCCACAGTGATTTTCCGCTAAAGGCGCCGCATAGATAGACACGTACGTAGACACGTACGTTCGTTCAGTGATA

Full Affymetrix probeset data:

Annotations for 1639544_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime