Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639551_at:

>probe:Drosophila_2:1639551_at:706:661; Interrogation_Position=3944; Antisense; TAACAGTAATACTGCCTCTTCCACG
>probe:Drosophila_2:1639551_at:480:571; Interrogation_Position=3974; Antisense; GGCTAGTTCAGTTTTGTTACCACAA
>probe:Drosophila_2:1639551_at:557:441; Interrogation_Position=4004; Antisense; GATGTTGGCGCCTCATACGATAATG
>probe:Drosophila_2:1639551_at:327:387; Interrogation_Position=4028; Antisense; GAACAACTTTGTACCAGCAATGTGC
>probe:Drosophila_2:1639551_at:689:541; Interrogation_Position=4080; Antisense; GGATTATGTAGTTCTCCACCAAATA
>probe:Drosophila_2:1639551_at:219:721; Interrogation_Position=4135; Antisense; TTGCTGAATCAAGTCGTCCATCGTC
>probe:Drosophila_2:1639551_at:259:219; Interrogation_Position=4145; Antisense; AAGTCGTCCATCGTCATATGTTGAC
>probe:Drosophila_2:1639551_at:324:601; Interrogation_Position=4163; Antisense; TGTTGACGCTGAGGGTAACCGCATT
>probe:Drosophila_2:1639551_at:8:459; Interrogation_Position=4190; Antisense; GATTTGCCCCGCTTGTGGAAAGGTC
>probe:Drosophila_2:1639551_at:547:535; Interrogation_Position=4211; Antisense; GGTCGACGATGGATCAGCTATGATT
>probe:Drosophila_2:1639551_at:638:681; Interrogation_Position=4229; Antisense; TATGATTGGTTGTGACGGCTGCGAC
>probe:Drosophila_2:1639551_at:211:141; Interrogation_Position=4243; Antisense; ACGGCTGCGACGCTTGGTATCATTG
>probe:Drosophila_2:1639551_at:122:513; Interrogation_Position=4273; Antisense; GTGTTGGTATAACCTTTGCACCGAA
>probe:Drosophila_2:1639551_at:624:589; Interrogation_Position=4311; Antisense; TGGTTCTGTCGCGTTTGCGTAACAA

Paste this into a BLAST search page for me
TAACAGTAATACTGCCTCTTCCACGGGCTAGTTCAGTTTTGTTACCACAAGATGTTGGCGCCTCATACGATAATGGAACAACTTTGTACCAGCAATGTGCGGATTATGTAGTTCTCCACCAAATATTGCTGAATCAAGTCGTCCATCGTCAAGTCGTCCATCGTCATATGTTGACTGTTGACGCTGAGGGTAACCGCATTGATTTGCCCCGCTTGTGGAAAGGTCGGTCGACGATGGATCAGCTATGATTTATGATTGGTTGTGACGGCTGCGACACGGCTGCGACGCTTGGTATCATTGGTGTTGGTATAACCTTTGCACCGAATGGTTCTGTCGCGTTTGCGTAACAA

Full Affymetrix probeset data:

Annotations for 1639551_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime