Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639552_s_at:

>probe:Drosophila_2:1639552_s_at:133:457; Interrogation_Position=311; Antisense; GATATCCCAGTTGTCGAAGTCACCC
>probe:Drosophila_2:1639552_s_at:290:373; Interrogation_Position=326; Antisense; GAAGTCACCCGAAAGCCACAAGAGA
>probe:Drosophila_2:1639552_s_at:526:529; Interrogation_Position=367; Antisense; GGGATGACTACTTTATGGCCACCTC
>probe:Drosophila_2:1639552_s_at:121:589; Interrogation_Position=476; Antisense; TGGATACAATGGGTTCCCTCGCAAC
>probe:Drosophila_2:1639552_s_at:137:195; Interrogation_Position=498; Antisense; AACTGCAGCGATGACGTGTTTCCGT
>probe:Drosophila_2:1639552_s_at:717:371; Interrogation_Position=510; Antisense; GACGTGTTTCCGTGGTCAAAAGCTA
>probe:Drosophila_2:1639552_s_at:313:227; Interrogation_Position=538; Antisense; AAGGCTCGCAGGAATTTGATCCCCT
>probe:Drosophila_2:1639552_s_at:31:133; Interrogation_Position=589; Antisense; ACGCGGAGGCCAATGCAATCCTGAA
>probe:Drosophila_2:1639552_s_at:90:563; Interrogation_Position=636; Antisense; GGAACTCGACTGTATACCACACTAT
>probe:Drosophila_2:1639552_s_at:684:127; Interrogation_Position=651; Antisense; ACCACACTATTTCCGTGCAACGAAT
>probe:Drosophila_2:1639552_s_at:92:39; Interrogation_Position=704; Antisense; ATCTCAGGTGCTATATTTGTCCGAC
>probe:Drosophila_2:1639552_s_at:119:659; Interrogation_Position=740; Antisense; TAAGCCCACATATCGTGCATCCAAG
>probe:Drosophila_2:1639552_s_at:224:605; Interrogation_Position=830; Antisense; TGATTTTGACACCTTCCCGGAAGAA
>probe:Drosophila_2:1639552_s_at:41:185; Interrogation_Position=853; Antisense; AAGATCCGAATGCATCCCTGGGACT

Paste this into a BLAST search page for me
GATATCCCAGTTGTCGAAGTCACCCGAAGTCACCCGAAAGCCACAAGAGAGGGATGACTACTTTATGGCCACCTCTGGATACAATGGGTTCCCTCGCAACAACTGCAGCGATGACGTGTTTCCGTGACGTGTTTCCGTGGTCAAAAGCTAAAGGCTCGCAGGAATTTGATCCCCTACGCGGAGGCCAATGCAATCCTGAAGGAACTCGACTGTATACCACACTATACCACACTATTTCCGTGCAACGAATATCTCAGGTGCTATATTTGTCCGACTAAGCCCACATATCGTGCATCCAAGTGATTTTGACACCTTCCCGGAAGAAAAGATCCGAATGCATCCCTGGGACT

Full Affymetrix probeset data:

Annotations for 1639552_s_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime