Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

 University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639553_at:

>probe:Drosophila_2:1639553_at:565:443; Interrogation_Position=1150; Antisense; GATGATCTCGACATGCACGTTATCT
>probe:Drosophila_2:1639553_at:536:475; Interrogation_Position=1168; Antisense; GTTATCTATGACGTTTCGCACAATA
>probe:Drosophila_2:1639553_at:191:103; Interrogation_Position=1235; Antisense; AGCTGTTGGTTCACCGGAAGGGCTC
>probe:Drosophila_2:1639553_at:629:83; Interrogation_Position=1296; Antisense; AGTGGACTATCAGCTTACCGGGCAG
>probe:Drosophila_2:1639553_at:452:495; Interrogation_Position=1330; Antisense; GTCGGTGGAACCATGGGCACTTGCA
>probe:Drosophila_2:1639553_at:531:525; Interrogation_Position=1344; Antisense; GGGCACTTGCAGTTACGTGCTAACT
>probe:Drosophila_2:1639553_at:203:73; Interrogation_Position=1388; Antisense; AGGAGACGTTCGGTAGCACTTGCCA
>probe:Drosophila_2:1639553_at:28:537; Interrogation_Position=1420; Antisense; GGTCGTGCACTATCTCGAGCCAAAT
>probe:Drosophila_2:1639553_at:619:45; Interrogation_Position=1443; Antisense; ATCCCGGCGCAATCTGGACTACAAG
>probe:Drosophila_2:1639553_at:360:207; Interrogation_Position=1480; Antisense; AAGCTGGACCAGTTGGGCATCGCCA
>probe:Drosophila_2:1639553_at:380:77; Interrogation_Position=1535; Antisense; AGGAGGCACCCGAATCTTACAAGGA
>probe:Drosophila_2:1639553_at:110:443; Interrogation_Position=1567; Antisense; GATGTGGTCGACACCTGTCACGCAG
>probe:Drosophila_2:1639553_at:205:99; Interrogation_Position=1616; Antisense; AGATGCGCCCAATTGCAGTTATCAA
>probe:Drosophila_2:1639553_at:486:189; Interrogation_Position=1678; Antisense; AACATTTGGTCCGATGGCTGTCAAT

Paste this into a BLAST search page for me
GATGATCTCGACATGCACGTTATCTGTTATCTATGACGTTTCGCACAATAAGCTGTTGGTTCACCGGAAGGGCTCAGTGGACTATCAGCTTACCGGGCAGGTCGGTGGAACCATGGGCACTTGCAGGGCACTTGCAGTTACGTGCTAACTAGGAGACGTTCGGTAGCACTTGCCAGGTCGTGCACTATCTCGAGCCAAATATCCCGGCGCAATCTGGACTACAAGAAGCTGGACCAGTTGGGCATCGCCAAGGAGGCACCCGAATCTTACAAGGAGATGTGGTCGACACCTGTCACGCAGAGATGCGCCCAATTGCAGTTATCAAAACATTTGGTCCGATGGCTGTCAAT

Full Affymetrix probeset data:

Annotations for 1639553_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime