FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639554_at:

>probe:Drosophila_2:1639554_at:244:631; Interrogation_Position=1195; Antisense; TCCTGCGCTACGAGGATGGCATTGA
>probe:Drosophila_2:1639554_at:220:77; Interrogation_Position=1228; Antisense; AGGAGATCGTCATTTGCACCACCAA
>probe:Drosophila_2:1639554_at:442:115; Interrogation_Position=1245; Antisense; ACCACCAAGGGTGAGGCCATTTGCC
>probe:Drosophila_2:1639554_at:242:147; Interrogation_Position=1296; Antisense; ACTATGGCCTCTTGTGACCATGGTG
>probe:Drosophila_2:1639554_at:354:129; Interrogation_Position=1312; Antisense; ACCATGGTGTGGTGGCCAAGATCAA
>probe:Drosophila_2:1639554_at:254:587; Interrogation_Position=1348; Antisense; TGGAGCGAGACACATACCCGCGCAA
>probe:Drosophila_2:1639554_at:99:227; Interrogation_Position=1389; Antisense; AAGGCGTCGGCCAAGAAGGCGCTCA
>probe:Drosophila_2:1639554_at:649:259; Interrogation_Position=1459; Antisense; CACCTAAGGAGTGGCTGACCGGTTA
>probe:Drosophila_2:1639554_at:380:571; Interrogation_Position=1471; Antisense; GGCTGACCGGTTATGTCGACTACAA
>probe:Drosophila_2:1639554_at:418:203; Interrogation_Position=1503; Antisense; AAGCCAGCAGCTCAAGAAGTCTCCC
>probe:Drosophila_2:1639554_at:187:169; Interrogation_Position=1532; Antisense; AAATGGCTCCAGTGAACCCAGCAAA
>probe:Drosophila_2:1639554_at:3:361; Interrogation_Position=1558; Antisense; GCAAGTTAAGCACCTCCAGCGTTGA
>probe:Drosophila_2:1639554_at:423:483; Interrogation_Position=1602; Antisense; GTATCCGAGGAGACTCCTTCCAAGG
>probe:Drosophila_2:1639554_at:513:73; Interrogation_Position=1663; Antisense; AGGAAGCCCCAGAAGCCGCTGAGGA

Paste this into a BLAST search page for me
TCCTGCGCTACGAGGATGGCATTGAAGGAGATCGTCATTTGCACCACCAAACCACCAAGGGTGAGGCCATTTGCCACTATGGCCTCTTGTGACCATGGTGACCATGGTGTGGTGGCCAAGATCAATGGAGCGAGACACATACCCGCGCAAAAGGCGTCGGCCAAGAAGGCGCTCACACCTAAGGAGTGGCTGACCGGTTAGGCTGACCGGTTATGTCGACTACAAAAGCCAGCAGCTCAAGAAGTCTCCCAAATGGCTCCAGTGAACCCAGCAAAGCAAGTTAAGCACCTCCAGCGTTGAGTATCCGAGGAGACTCCTTCCAAGGAGGAAGCCCCAGAAGCCGCTGAGGA

Full Affymetrix probeset data:

Annotations for 1639554_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720