Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639555_at:

>probe:Drosophila_2:1639555_at:492:357; Interrogation_Position=3291; Antisense; GCAACGTATTTCATGTAGTATTTAT
>probe:Drosophila_2:1639555_at:31:661; Interrogation_Position=3350; Antisense; TAACTATTTCCATTCGTGTGACCCG
>probe:Drosophila_2:1639555_at:143:313; Interrogation_Position=3377; Antisense; GCCACCTTTGTCATTACACTTTCTT
>probe:Drosophila_2:1639555_at:389:157; Interrogation_Position=3392; Antisense; ACACTTTCTTTTGCCATGTTGTATA
>probe:Drosophila_2:1639555_at:453:475; Interrogation_Position=3473; Antisense; GTTATGCCATTCGTACACAAATAGG
>probe:Drosophila_2:1639555_at:652:561; Interrogation_Position=3496; Antisense; GGAATTCAAGCATAGCACCGACCCA
>probe:Drosophila_2:1639555_at:66:353; Interrogation_Position=3510; Antisense; GCACCGACCCATACTTTAGACTAAA
>probe:Drosophila_2:1639555_at:431:473; Interrogation_Position=3550; Antisense; GTTCTTGTGAAACCAACGGCCCAAG
>probe:Drosophila_2:1639555_at:499:427; Interrogation_Position=3581; Antisense; GAGATACCACACACACATTAGGCTA
>probe:Drosophila_2:1639555_at:414:675; Interrogation_Position=3598; Antisense; TTAGGCTAAGCGAAACCAGGTTAAG
>probe:Drosophila_2:1639555_at:477:321; Interrogation_Position=3635; Antisense; GAGTTACTTTAACCGATGGAAGACA
>probe:Drosophila_2:1639555_at:116:241; Interrogation_Position=3669; Antisense; AATAGCTTGTAGTACGTACTCTAAG
>probe:Drosophila_2:1639555_at:703:177; Interrogation_Position=3705; Antisense; AAACTGAGTTGCACTTCTGTAAGAT
>probe:Drosophila_2:1639555_at:49:211; Interrogation_Position=3768; Antisense; AAGCAACTCGAGTAGCCTACATAAT

Paste this into a BLAST search page for me
GCAACGTATTTCATGTAGTATTTATTAACTATTTCCATTCGTGTGACCCGGCCACCTTTGTCATTACACTTTCTTACACTTTCTTTTGCCATGTTGTATAGTTATGCCATTCGTACACAAATAGGGGAATTCAAGCATAGCACCGACCCAGCACCGACCCATACTTTAGACTAAAGTTCTTGTGAAACCAACGGCCCAAGGAGATACCACACACACATTAGGCTATTAGGCTAAGCGAAACCAGGTTAAGGAGTTACTTTAACCGATGGAAGACAAATAGCTTGTAGTACGTACTCTAAGAAACTGAGTTGCACTTCTGTAAGATAAGCAACTCGAGTAGCCTACATAAT

Full Affymetrix probeset data:

Annotations for 1639555_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime