Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639556_at:

>probe:Drosophila_2:1639556_at:358:95; Interrogation_Position=1248; Antisense; AGATCCGCTTGATCCTAACGATCGG
>probe:Drosophila_2:1639556_at:127:661; Interrogation_Position=1263; Antisense; TAACGATCGGCATCAGTCCTCCAGG
>probe:Drosophila_2:1639556_at:644:627; Interrogation_Position=1282; Antisense; TCCAGGACCTCACTTCGTAAGAGAG
>probe:Drosophila_2:1639556_at:326:111; Interrogation_Position=1319; Antisense; AGCAATTTGAGGAGCACATGCCCAA
>probe:Drosophila_2:1639556_at:293:547; Interrogation_Position=1374; Antisense; GGATGAGCTGATGCCACTTAACACT
>probe:Drosophila_2:1639556_at:450:149; Interrogation_Position=1389; Antisense; ACTTAACACTGATCTGCCCAAGCAG
>probe:Drosophila_2:1639556_at:655:115; Interrogation_Position=1409; Antisense; AGCAGGAACATCTCTTCGATAGCGA
>probe:Drosophila_2:1639556_at:328:721; Interrogation_Position=1442; Antisense; TTGCCAATAATGCTCGGGATCCACC
>probe:Drosophila_2:1639556_at:126:529; Interrogation_Position=1457; Antisense; GGGATCCACCTCGTTATTTGATTCA
>probe:Drosophila_2:1639556_at:561:23; Interrogation_Position=1514; Antisense; ATAGTGGCGAGCGTCGATTGCTTGA
>probe:Drosophila_2:1639556_at:417:179; Interrogation_Position=1563; Antisense; AAACATGGACAAACTCACCGAGGAG
>probe:Drosophila_2:1639556_at:727:109; Interrogation_Position=1652; Antisense; AGAATACTGATGACTCTCCCGAGGG
>probe:Drosophila_2:1639556_at:313:77; Interrogation_Position=1673; Antisense; AGGGTGGCCGGATCAACGCTCATGC
>probe:Drosophila_2:1639556_at:420:647; Interrogation_Position=1692; Antisense; TCATGCGGCATTGAGGCAGTCCAAT

Paste this into a BLAST search page for me
AGATCCGCTTGATCCTAACGATCGGTAACGATCGGCATCAGTCCTCCAGGTCCAGGACCTCACTTCGTAAGAGAGAGCAATTTGAGGAGCACATGCCCAAGGATGAGCTGATGCCACTTAACACTACTTAACACTGATCTGCCCAAGCAGAGCAGGAACATCTCTTCGATAGCGATTGCCAATAATGCTCGGGATCCACCGGGATCCACCTCGTTATTTGATTCAATAGTGGCGAGCGTCGATTGCTTGAAAACATGGACAAACTCACCGAGGAGAGAATACTGATGACTCTCCCGAGGGAGGGTGGCCGGATCAACGCTCATGCTCATGCGGCATTGAGGCAGTCCAAT

Full Affymetrix probeset data:

Annotations for 1639556_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime