FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639558_at:

>probe:Drosophila_2:1639558_at:680:555; Interrogation_Position=103; Antisense; GGACTGCCGGGCACGGATGGCATTC
>probe:Drosophila_2:1639558_at:28:53; Interrogation_Position=13; Antisense; ATGCTTATTTTCGAGGCAGGTCCTC
>probe:Drosophila_2:1639558_at:606:677; Interrogation_Position=18; Antisense; TATTTTCGAGGCAGGTCCTCCGGGC
>probe:Drosophila_2:1639558_at:670:573; Interrogation_Position=296; Antisense; GGCGGCCGCCAAAGGAGCCAATCAT
>probe:Drosophila_2:1639558_at:629:553; Interrogation_Position=309; Antisense; GGAGCCAATCATCTCGACGCCCGTG
>probe:Drosophila_2:1639558_at:694:633; Interrogation_Position=322; Antisense; TCGACGCCCGTGCACAAGGATTATT
>probe:Drosophila_2:1639558_at:575:629; Interrogation_Position=33; Antisense; TCCTCCGGGCTTGGATGGCATGAAG
>probe:Drosophila_2:1639558_at:275:291; Interrogation_Position=330; Antisense; CGTGCACAAGGATTATTTGCCCGAT
>probe:Drosophila_2:1639558_at:435:19; Interrogation_Position=344; Antisense; ATTTGCCCGATGTAACGCAGCCGGA
>probe:Drosophila_2:1639558_at:161:661; Interrogation_Position=356; Antisense; TAACGCAGCCGGAAAGCAACACCAG
>probe:Drosophila_2:1639558_at:666:559; Interrogation_Position=366; Antisense; GGAAAGCAACACCAGCGATTACGAG
>probe:Drosophila_2:1639558_at:694:155; Interrogation_Position=374; Antisense; ACACCAGCGATTACGAGCAGGAGGA
>probe:Drosophila_2:1639558_at:712:363; Interrogation_Position=445; Antisense; GAATATCAGGATAATTTGCATAACA
>probe:Drosophila_2:1639558_at:257:319; Interrogation_Position=59; Antisense; GCGCCCAGGGCGAGACGGGACACAA

Paste this into a BLAST search page for me
GGACTGCCGGGCACGGATGGCATTCATGCTTATTTTCGAGGCAGGTCCTCTATTTTCGAGGCAGGTCCTCCGGGCGGCGGCCGCCAAAGGAGCCAATCATGGAGCCAATCATCTCGACGCCCGTGTCGACGCCCGTGCACAAGGATTATTTCCTCCGGGCTTGGATGGCATGAAGCGTGCACAAGGATTATTTGCCCGATATTTGCCCGATGTAACGCAGCCGGATAACGCAGCCGGAAAGCAACACCAGGGAAAGCAACACCAGCGATTACGAGACACCAGCGATTACGAGCAGGAGGAGAATATCAGGATAATTTGCATAACAGCGCCCAGGGCGAGACGGGACACAA

Full Affymetrix probeset data:

Annotations for 1639558_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720