FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639559_at:

>probe:Drosophila_2:1639559_at:633:381; Interrogation_Position=1061; Antisense; GAACGGATCACTTGCGTGGGTCACT
>probe:Drosophila_2:1639559_at:617:151; Interrogation_Position=1098; Antisense; ACATCTGCGGCATGATCAGCAACCA
>probe:Drosophila_2:1639559_at:118:485; Interrogation_Position=1138; Antisense; GTATCGCATCATTGGATTGGATCCC
>probe:Drosophila_2:1639559_at:464:321; Interrogation_Position=1163; Antisense; GCCCGGCCTTTAATTGAGCGCATGA
>probe:Drosophila_2:1639559_at:364:711; Interrogation_Position=1200; Antisense; TTCGGTTGTCGATCGATGATGCCAA
>probe:Drosophila_2:1639559_at:112:607; Interrogation_Position=1216; Antisense; TGATGCCAACGTCATTCAGGTGCTC
>probe:Drosophila_2:1639559_at:249:659; Interrogation_Position=1273; Antisense; TAACTCCGGGCATCTAAACTACTGT
>probe:Drosophila_2:1639559_at:303:143; Interrogation_Position=1293; Antisense; ACTGTGTCAACGGTGGACGCATCCA
>probe:Drosophila_2:1639559_at:586:59; Interrogation_Position=1354; Antisense; ATGTTCGCACTTCTTGAGCATCTGC
>probe:Drosophila_2:1639559_at:2:581; Interrogation_Position=1383; Antisense; TGGCCACTGCCACATTTAAACACAA
>probe:Drosophila_2:1639559_at:97:573; Interrogation_Position=1436; Antisense; GGCTGCCTGAATCTTAGTGGATCCA
>probe:Drosophila_2:1639559_at:665:169; Interrogation_Position=1481; Antisense; AAAGTGAATCCCTTCGAGTTCGCCT
>probe:Drosophila_2:1639559_at:33:95; Interrogation_Position=1497; Antisense; AGTTCGCCTCGCTGATAAGGGAGTA
>probe:Drosophila_2:1639559_at:386:629; Interrogation_Position=978; Antisense; TCCACTCGCTTATAAACACCAGGTT

Paste this into a BLAST search page for me
GAACGGATCACTTGCGTGGGTCACTACATCTGCGGCATGATCAGCAACCAGTATCGCATCATTGGATTGGATCCCGCCCGGCCTTTAATTGAGCGCATGATTCGGTTGTCGATCGATGATGCCAATGATGCCAACGTCATTCAGGTGCTCTAACTCCGGGCATCTAAACTACTGTACTGTGTCAACGGTGGACGCATCCAATGTTCGCACTTCTTGAGCATCTGCTGGCCACTGCCACATTTAAACACAAGGCTGCCTGAATCTTAGTGGATCCAAAAGTGAATCCCTTCGAGTTCGCCTAGTTCGCCTCGCTGATAAGGGAGTATCCACTCGCTTATAAACACCAGGTT

Full Affymetrix probeset data:

Annotations for 1639559_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720