Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639562_at:

>probe:Drosophila_2:1639562_at:92:149; Interrogation_Position=118; Antisense; ACTTCCAATTCATCGACTCCATCGA
>probe:Drosophila_2:1639562_at:34:45; Interrogation_Position=138; Antisense; ATCGACTTCCAGCTCAAGTTCGACA
>probe:Drosophila_2:1639562_at:338:653; Interrogation_Position=151; Antisense; TCAAGTTCGACACCCAGCTCTTCGT
>probe:Drosophila_2:1639562_at:678:651; Interrogation_Position=184; Antisense; TCAACTCCGTCCAGCAATAGCACTA
>probe:Drosophila_2:1639562_at:429:239; Interrogation_Position=199; Antisense; AATAGCACTACGTCTACTTCGTCCT
>probe:Drosophila_2:1639562_at:10:287; Interrogation_Position=31; Antisense; CTGGCCTTTGGTTTGGTTGTCCTCG
>probe:Drosophila_2:1639562_at:268:587; Interrogation_Position=44; Antisense; TGGTTGTCCTCGTGGCGACCGTTTA
>probe:Drosophila_2:1639562_at:213:87; Interrogation_Position=451; Antisense; AGTCGTGCTGGAAGAAGGCGCCAAC
>probe:Drosophila_2:1639562_at:408:661; Interrogation_Position=484; Antisense; TAAACCATCGGCTTAACCCGATCGA
>probe:Drosophila_2:1639562_at:412:549; Interrogation_Position=493; Antisense; GGCTTAACCCGATCGAACAATGAAA
>probe:Drosophila_2:1639562_at:332:359; Interrogation_Position=552; Antisense; GCAACAATCGTAGTTATGACTTGGT
>probe:Drosophila_2:1639562_at:639:581; Interrogation_Position=56; Antisense; TGGCGACCGTTTATGGTGGCACCGA
>probe:Drosophila_2:1639562_at:356:33; Interrogation_Position=567; Antisense; ATGACTTGGTAACTTGGCACCTTAA
>probe:Drosophila_2:1639562_at:488:65; Interrogation_Position=68; Antisense; ATGGTGGCACCGACTCATCCTCGAG

Paste this into a BLAST search page for me
ACTTCCAATTCATCGACTCCATCGAATCGACTTCCAGCTCAAGTTCGACATCAAGTTCGACACCCAGCTCTTCGTTCAACTCCGTCCAGCAATAGCACTAAATAGCACTACGTCTACTTCGTCCTCTGGCCTTTGGTTTGGTTGTCCTCGTGGTTGTCCTCGTGGCGACCGTTTAAGTCGTGCTGGAAGAAGGCGCCAACTAAACCATCGGCTTAACCCGATCGAGGCTTAACCCGATCGAACAATGAAAGCAACAATCGTAGTTATGACTTGGTTGGCGACCGTTTATGGTGGCACCGAATGACTTGGTAACTTGGCACCTTAAATGGTGGCACCGACTCATCCTCGAG

Full Affymetrix probeset data:

Annotations for 1639562_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime