Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639564_a_at:

>probe:Drosophila_2:1639564_a_at:694:373; Interrogation_Position=113; Antisense; GAAGATGTCGTTGCCACGCGTTTAC
>probe:Drosophila_2:1639564_a_at:566:477; Interrogation_Position=132; Antisense; GTTTACTTCGATATAGCCGCAGGAG
>probe:Drosophila_2:1639564_a_at:198:189; Interrogation_Position=184; Antisense; AACTACGTTCGGATGTGGTGCCCAA
>probe:Drosophila_2:1639564_a_at:567:487; Interrogation_Position=251; Antisense; GTACGGCTACAAGGGATCACCATTC
>probe:Drosophila_2:1639564_a_at:611:327; Interrogation_Position=280; Antisense; GCGTCATCCCGAATTTCATGTGTCA
>probe:Drosophila_2:1639564_a_at:231:495; Interrogation_Position=301; Antisense; GTCAGGGCGGTGATTTCACTAATCA
>probe:Drosophila_2:1639564_a_at:555:115; Interrogation_Position=388; Antisense; AGCATACCGGAGCTGGTGTACTTTC
>probe:Drosophila_2:1639564_a_at:573:515; Interrogation_Position=403; Antisense; GTGTACTTTCGATGGCCAATGCTGG
>probe:Drosophila_2:1639564_a_at:322:521; Interrogation_Position=427; Antisense; GGGCCAATACCAATGGATCTCAGTT
>probe:Drosophila_2:1639564_a_at:703:451; Interrogation_Position=442; Antisense; GATCTCAGTTTTTCATTTGCACCGG
>probe:Drosophila_2:1639564_a_at:92:691; Interrogation_Position=457; Antisense; TTTGCACCGGGAAAACCACATGGCT
>probe:Drosophila_2:1639564_a_at:100:209; Interrogation_Position=489; Antisense; AAGCATGTCGTGTTCGGCAAGGTCG
>probe:Drosophila_2:1639564_a_at:470:663; Interrogation_Position=53; Antisense; TAAAGCTGACACCACCAAGTTATCC
>probe:Drosophila_2:1639564_a_at:58:245; Interrogation_Position=584; Antisense; AATTATCGAAGACTGCGGAGCCCTC

Paste this into a BLAST search page for me
GAAGATGTCGTTGCCACGCGTTTACGTTTACTTCGATATAGCCGCAGGAGAACTACGTTCGGATGTGGTGCCCAAGTACGGCTACAAGGGATCACCATTCGCGTCATCCCGAATTTCATGTGTCAGTCAGGGCGGTGATTTCACTAATCAAGCATACCGGAGCTGGTGTACTTTCGTGTACTTTCGATGGCCAATGCTGGGGGCCAATACCAATGGATCTCAGTTGATCTCAGTTTTTCATTTGCACCGGTTTGCACCGGGAAAACCACATGGCTAAGCATGTCGTGTTCGGCAAGGTCGTAAAGCTGACACCACCAAGTTATCCAATTATCGAAGACTGCGGAGCCCTC

Full Affymetrix probeset data:

Annotations for 1639564_a_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime