FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639567_at:

>probe:Drosophila_2:1639567_at:310:597; Interrogation_Position=310; Antisense; TGTGCGACTACTTCGAGGAGCTGAC
>probe:Drosophila_2:1639567_at:504:63; Interrogation_Position=364; Antisense; ATGTGGCTTACAGCGATGGCGTGCT
>probe:Drosophila_2:1639567_at:670:439; Interrogation_Position=378; Antisense; GATGGCGTGCTAACCGTGAACCTGG
>probe:Drosophila_2:1639567_at:544:567; Interrogation_Position=414; Antisense; GGCACCTATGTGATCAACCGGCAGA
>probe:Drosophila_2:1639567_at:93:187; Interrogation_Position=444; Antisense; AACAAGCAGATCTGGCTCAGTTCGC
>probe:Drosophila_2:1639567_at:655:455; Interrogation_Position=487; Antisense; GATACGATTTCGTCGGCACTGTGGC
>probe:Drosophila_2:1639567_at:19:113; Interrogation_Position=532; Antisense; AGCACAGTGGTCAGTCGCTGCACGA
>probe:Drosophila_2:1639567_at:21:429; Interrogation_Position=570; Antisense; GAGATACCCGGCATACTGAAGTCAC
>probe:Drosophila_2:1639567_at:532:671; Interrogation_Position=610; Antisense; TACGCCTGCCCTACTGTAGTTAATT
>probe:Drosophila_2:1639567_at:87:701; Interrogation_Position=695; Antisense; TTTATTGTTCTTCATCTGTTGGCAC
>probe:Drosophila_2:1639567_at:236:285; Interrogation_Position=710; Antisense; CTGTTGGCACAGTGGTCACTCGATA
>probe:Drosophila_2:1639567_at:502:637; Interrogation_Position=729; Antisense; TCGATATACATGGAACTGCTGCTGC
>probe:Drosophila_2:1639567_at:221:21; Interrogation_Position=771; Antisense; ATATACTTATACTTCCCTGGAGCTG
>probe:Drosophila_2:1639567_at:28:343; Interrogation_Position=820; Antisense; GCTTTGCATTCGCTTATTCATTTAT

Paste this into a BLAST search page for me
TGTGCGACTACTTCGAGGAGCTGACATGTGGCTTACAGCGATGGCGTGCTGATGGCGTGCTAACCGTGAACCTGGGGCACCTATGTGATCAACCGGCAGAAACAAGCAGATCTGGCTCAGTTCGCGATACGATTTCGTCGGCACTGTGGCAGCACAGTGGTCAGTCGCTGCACGAGAGATACCCGGCATACTGAAGTCACTACGCCTGCCCTACTGTAGTTAATTTTTATTGTTCTTCATCTGTTGGCACCTGTTGGCACAGTGGTCACTCGATATCGATATACATGGAACTGCTGCTGCATATACTTATACTTCCCTGGAGCTGGCTTTGCATTCGCTTATTCATTTAT

Full Affymetrix probeset data:

Annotations for 1639567_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720