FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639568_at:

>probe:Drosophila_2:1639568_at:57:469; Interrogation_Position=2319; Antisense; GTTGCCGGTACATTTTTCTTCAGTT
>probe:Drosophila_2:1639568_at:96:353; Interrogation_Position=2359; Antisense; GCACCCGTCAGATGCTTTACGTAAA
>probe:Drosophila_2:1639568_at:294:151; Interrogation_Position=2404; Antisense; ACATCGACACCCAGTTGCTTGTTAA
>probe:Drosophila_2:1639568_at:264:709; Interrogation_Position=2425; Antisense; TTAACCTGCTAAACACCATGTCCGT
>probe:Drosophila_2:1639568_at:576:513; Interrogation_Position=2448; Antisense; GTGTTGGTTATGTGCTCCCAGAACT
>probe:Drosophila_2:1639568_at:82:97; Interrogation_Position=2500; Antisense; AGATCTTTGACCTATGCGCCTTTGT
>probe:Drosophila_2:1639568_at:47:693; Interrogation_Position=2520; Antisense; TTTGTGCGTTTCAATGCCGAGGCCC
>probe:Drosophila_2:1639568_at:682:331; Interrogation_Position=2553; Antisense; GCGGCCACATTGCAGCTAATAGGAA
>probe:Drosophila_2:1639568_at:593:23; Interrogation_Position=2571; Antisense; ATAGGAATCGCCTTGGTAACCACAC
>probe:Drosophila_2:1639568_at:345:353; Interrogation_Position=2642; Antisense; GCAGCGCTGGCTGAATGACTTCATA
>probe:Drosophila_2:1639568_at:669:607; Interrogation_Position=2657; Antisense; TGACTTCATAAGATCGCCATTGGTG
>probe:Drosophila_2:1639568_at:287:431; Interrogation_Position=2700; Antisense; GAGTGTCGTGAACTGGCCCAAAGCA
>probe:Drosophila_2:1639568_at:416:585; Interrogation_Position=2728; Antisense; TGGACACCTGCTACAAACTCTTTGA
>probe:Drosophila_2:1639568_at:660:191; Interrogation_Position=2743; Antisense; AACTCTTTGATACAGCCGCCATGGA

Paste this into a BLAST search page for me
GTTGCCGGTACATTTTTCTTCAGTTGCACCCGTCAGATGCTTTACGTAAAACATCGACACCCAGTTGCTTGTTAATTAACCTGCTAAACACCATGTCCGTGTGTTGGTTATGTGCTCCCAGAACTAGATCTTTGACCTATGCGCCTTTGTTTTGTGCGTTTCAATGCCGAGGCCCGCGGCCACATTGCAGCTAATAGGAAATAGGAATCGCCTTGGTAACCACACGCAGCGCTGGCTGAATGACTTCATATGACTTCATAAGATCGCCATTGGTGGAGTGTCGTGAACTGGCCCAAAGCATGGACACCTGCTACAAACTCTTTGAAACTCTTTGATACAGCCGCCATGGA

Full Affymetrix probeset data:

Annotations for 1639568_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720