FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639570_at:

>probe:Drosophila_2:1639570_at:542:85; Interrogation_Position=1177; Antisense; AGTCCACCCGGTTCAGTGGTTAGCA
>probe:Drosophila_2:1639570_at:597:63; Interrogation_Position=1217; Antisense; ATGGTCTGATGATCAATCCGCGCTA
>probe:Drosophila_2:1639570_at:369:45; Interrogation_Position=1232; Antisense; ATCCGCGCTACTTGAGTAATCCGAC
>probe:Drosophila_2:1639570_at:13:655; Interrogation_Position=1248; Antisense; TAATCCGACCAACAATCAGGCGACG
>probe:Drosophila_2:1639570_at:152:565; Interrogation_Position=1274; Antisense; GGAATCTTCACCAGCAGGGTGGCTA
>probe:Drosophila_2:1639570_at:47:81; Interrogation_Position=1289; Antisense; AGGGTGGCTATTCCATGCAAGCATC
>probe:Drosophila_2:1639570_at:532:531; Interrogation_Position=1314; Antisense; GGGTCTCTCCCTCAAGGATAATGGC
>probe:Drosophila_2:1639570_at:249:453; Interrogation_Position=1351; Antisense; GATCTCCTGGGTAACTATCCGCATA
>probe:Drosophila_2:1639570_at:113:97; Interrogation_Position=1432; Antisense; AGATCCCGATCCCAAAAGAAGTCCA
>probe:Drosophila_2:1639570_at:442:121; Interrogation_Position=1549; Antisense; AGCGGCTTCAGTGCCAGCGATCTGA
>probe:Drosophila_2:1639570_at:626:39; Interrogation_Position=1568; Antisense; ATCTGAGTGGTCTGCTCGGCAAGGA
>probe:Drosophila_2:1639570_at:319:109; Interrogation_Position=1592; Antisense; AGAAGCCCGTGCATCGGTGCAGCAT
>probe:Drosophila_2:1639570_at:641:509; Interrogation_Position=1608; Antisense; GTGCAGCATCTGCAATCGCGGATTC
>probe:Drosophila_2:1639570_at:282:543; Interrogation_Position=1627; Antisense; GGATTCCTCAACAAGTCCAACATCA

Paste this into a BLAST search page for me
AGTCCACCCGGTTCAGTGGTTAGCAATGGTCTGATGATCAATCCGCGCTAATCCGCGCTACTTGAGTAATCCGACTAATCCGACCAACAATCAGGCGACGGGAATCTTCACCAGCAGGGTGGCTAAGGGTGGCTATTCCATGCAAGCATCGGGTCTCTCCCTCAAGGATAATGGCGATCTCCTGGGTAACTATCCGCATAAGATCCCGATCCCAAAAGAAGTCCAAGCGGCTTCAGTGCCAGCGATCTGAATCTGAGTGGTCTGCTCGGCAAGGAAGAAGCCCGTGCATCGGTGCAGCATGTGCAGCATCTGCAATCGCGGATTCGGATTCCTCAACAAGTCCAACATCA

Full Affymetrix probeset data:

Annotations for 1639570_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720