FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639572_at:

>probe:Drosophila_2:1639572_at:491:449; Interrogation_Position=273; Antisense; GATCCGAAGCTGTTTTTTCCCAGAG
>probe:Drosophila_2:1639572_at:72:683; Interrogation_Position=317; Antisense; TATACAAGTCCTACAGCTTCAGCGT
>probe:Drosophila_2:1639572_at:667:345; Interrogation_Position=344; Antisense; GCATCACCGAGTGCATTAGGCGTTT
>probe:Drosophila_2:1639572_at:729:193; Interrogation_Position=385; Antisense; AACTGCACGTCATTCCTGTACAATC
>probe:Drosophila_2:1639572_at:352:141; Interrogation_Position=423; Antisense; ACGGTATCCGGACTGCGATCTTGAG
>probe:Drosophila_2:1639572_at:638:37; Interrogation_Position=440; Antisense; ATCTTGAGGGATTCTTGTGTCTGGA
>probe:Drosophila_2:1639572_at:126:455; Interrogation_Position=477; Antisense; GATCAAGCCAGATTCCAGGGTGCTG
>probe:Drosophila_2:1639572_at:707:185; Interrogation_Position=520; Antisense; AACAATGCAAGTTGCGGCTGCCTGC
>probe:Drosophila_2:1639572_at:9:625; Interrogation_Position=542; Antisense; TGCCGTCCTGCAATGATGGCGACAT
>probe:Drosophila_2:1639572_at:477:575; Interrogation_Position=559; Antisense; GGCGACATTACTACCATCTACGAGC
>probe:Drosophila_2:1639572_at:231:125; Interrogation_Position=581; Antisense; AGCCACTCTTATTTGTTCGGAATCC
>probe:Drosophila_2:1639572_at:2:661; Interrogation_Position=616; Antisense; TACAACGGAACTCTGGACATGCCCT
>probe:Drosophila_2:1639572_at:276:649; Interrogation_Position=743; Antisense; TCAGTGCCATCGAGTTTGTCTACTA
>probe:Drosophila_2:1639572_at:263:729; Interrogation_Position=758; Antisense; TTGTCTACTATTTCACAGTGCGACC

Paste this into a BLAST search page for me
GATCCGAAGCTGTTTTTTCCCAGAGTATACAAGTCCTACAGCTTCAGCGTGCATCACCGAGTGCATTAGGCGTTTAACTGCACGTCATTCCTGTACAATCACGGTATCCGGACTGCGATCTTGAGATCTTGAGGGATTCTTGTGTCTGGAGATCAAGCCAGATTCCAGGGTGCTGAACAATGCAAGTTGCGGCTGCCTGCTGCCGTCCTGCAATGATGGCGACATGGCGACATTACTACCATCTACGAGCAGCCACTCTTATTTGTTCGGAATCCTACAACGGAACTCTGGACATGCCCTTCAGTGCCATCGAGTTTGTCTACTATTGTCTACTATTTCACAGTGCGACC

Full Affymetrix probeset data:

Annotations for 1639572_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720