FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639575_at:

>probe:Drosophila_2:1639575_at:65:113; Interrogation_Position=1586; Antisense; AGCAAAGTATCAACCGGCCAGCGAG
>probe:Drosophila_2:1639575_at:510:329; Interrogation_Position=1614; Antisense; GCGGACAAGTATCTGGTTGCGCCAC
>probe:Drosophila_2:1639575_at:272:367; Interrogation_Position=1659; Antisense; GAATCGGGTTTTACGATCACGTCCA
>probe:Drosophila_2:1639575_at:413:177; Interrogation_Position=1683; Antisense; AAACGGACATATCCACTTCGTTCGC
>probe:Drosophila_2:1639575_at:53:669; Interrogation_Position=1710; Antisense; TACTTCAATCCGGATCTATGGCTGG
>probe:Drosophila_2:1639575_at:683:573; Interrogation_Position=1729; Antisense; GGCTGGACTGCGATTCATACTTATA
>probe:Drosophila_2:1639575_at:267:215; Interrogation_Position=1808; Antisense; AAGATAGCCAATAGCGCCCTTGTTA
>probe:Drosophila_2:1639575_at:595:33; Interrogation_Position=1849; Antisense; ATCACTTCGTTTCATGGAGCTTCTG
>probe:Drosophila_2:1639575_at:216:553; Interrogation_Position=1864; Antisense; GGAGCTTCTGACTATGTACGATGTA
>probe:Drosophila_2:1639575_at:340:253; Interrogation_Position=1922; Antisense; CAAGCGATTTATTCTGTAGCCTCAG
>probe:Drosophila_2:1639575_at:257:487; Interrogation_Position=1937; Antisense; GTAGCCTCAGCACTTTGGATCTGGA
>probe:Drosophila_2:1639575_at:667:729; Interrogation_Position=1951; Antisense; TTGGATCTGGATCTCGACGTCGAAG
>probe:Drosophila_2:1639575_at:440:657; Interrogation_Position=2041; Antisense; TAAGCACTCGGACGCTCAAATTCGT
>probe:Drosophila_2:1639575_at:2:163; Interrogation_Position=2058; Antisense; AAATTCGTCCGTTTCTGTCATAAGT

Paste this into a BLAST search page for me
AGCAAAGTATCAACCGGCCAGCGAGGCGGACAAGTATCTGGTTGCGCCACGAATCGGGTTTTACGATCACGTCCAAAACGGACATATCCACTTCGTTCGCTACTTCAATCCGGATCTATGGCTGGGGCTGGACTGCGATTCATACTTATAAAGATAGCCAATAGCGCCCTTGTTAATCACTTCGTTTCATGGAGCTTCTGGGAGCTTCTGACTATGTACGATGTACAAGCGATTTATTCTGTAGCCTCAGGTAGCCTCAGCACTTTGGATCTGGATTGGATCTGGATCTCGACGTCGAAGTAAGCACTCGGACGCTCAAATTCGTAAATTCGTCCGTTTCTGTCATAAGT

Full Affymetrix probeset data:

Annotations for 1639575_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720