Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639576_at:

>probe:Drosophila_2:1639576_at:159:507; Interrogation_Position=2449; Antisense; GTGCCGCCTCAAATCTGGACTCGAA
>probe:Drosophila_2:1639576_at:178:109; Interrogation_Position=2506; Antisense; AGAAGCCAGCTTCGGCGTATCCCAA
>probe:Drosophila_2:1639576_at:516:331; Interrogation_Position=2536; Antisense; GCGGCCTGGTCAACAAATAATCACA
>probe:Drosophila_2:1639576_at:399:615; Interrogation_Position=2578; Antisense; TGAATTGCATCTAACCATTGTCGTG
>probe:Drosophila_2:1639576_at:316:497; Interrogation_Position=2633; Antisense; GTCATCGCAATATGTACACCTCGGT
>probe:Drosophila_2:1639576_at:427:663; Interrogation_Position=2647; Antisense; TACACCTCGGTACTTTTAGCCCAAT
>probe:Drosophila_2:1639576_at:197:39; Interrogation_Position=2670; Antisense; ATCTACTCACATTTCACGCTTTGTA
>probe:Drosophila_2:1639576_at:181:701; Interrogation_Position=2709; Antisense; TTTTAAGTCATCTCATGCACTGGCC
>probe:Drosophila_2:1639576_at:583:615; Interrogation_Position=2724; Antisense; TGCACTGGCCCTAGAATTATAAAGA
>probe:Drosophila_2:1639576_at:304:233; Interrogation_Position=2773; Antisense; AATGCCATATGCCTTGAGTGACTTG
>probe:Drosophila_2:1639576_at:507:433; Interrogation_Position=2788; Antisense; GAGTGACTTGGCCAGTCGACCCCAA
>probe:Drosophila_2:1639576_at:668:59; Interrogation_Position=2834; Antisense; ATGTTTATTTGTTACTCGACTCGAA
>probe:Drosophila_2:1639576_at:323:151; Interrogation_Position=2883; Antisense; ACATACGTACGTTTTGTGTTCGATT
>probe:Drosophila_2:1639576_at:297:473; Interrogation_Position=2927; Antisense; GTTAAATCCAGCTGCAACTGTCTAT

Paste this into a BLAST search page for me
GTGCCGCCTCAAATCTGGACTCGAAAGAAGCCAGCTTCGGCGTATCCCAAGCGGCCTGGTCAACAAATAATCACATGAATTGCATCTAACCATTGTCGTGGTCATCGCAATATGTACACCTCGGTTACACCTCGGTACTTTTAGCCCAATATCTACTCACATTTCACGCTTTGTATTTTAAGTCATCTCATGCACTGGCCTGCACTGGCCCTAGAATTATAAAGAAATGCCATATGCCTTGAGTGACTTGGAGTGACTTGGCCAGTCGACCCCAAATGTTTATTTGTTACTCGACTCGAAACATACGTACGTTTTGTGTTCGATTGTTAAATCCAGCTGCAACTGTCTAT

Full Affymetrix probeset data:

Annotations for 1639576_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime