FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639581_at:

>probe:Drosophila_2:1639581_at:705:435; Interrogation_Position=1701; Antisense; GAGGAACTCTCGCACATTTGGAACT
>probe:Drosophila_2:1639581_at:30:357; Interrogation_Position=1712; Antisense; GCACATTTGGAACTCCCAGCAGGAG
>probe:Drosophila_2:1639581_at:65:193; Interrogation_Position=1740; Antisense; AACTTTGAGTTGACCAGCTCGCCAA
>probe:Drosophila_2:1639581_at:24:163; Interrogation_Position=1763; Antisense; AAATTCGAGTGGCACACCTACTGCG
>probe:Drosophila_2:1639581_at:387:129; Interrogation_Position=1778; Antisense; ACCTACTGCGACCACTGTAGCTGGT
>probe:Drosophila_2:1639581_at:267:485; Interrogation_Position=1794; Antisense; GTAGCTGGTGGTTCCCAAAGCCGAA
>probe:Drosophila_2:1639581_at:654:203; Interrogation_Position=1811; Antisense; AAGCCGAAGAATTGGCACCCGTGGA
>probe:Drosophila_2:1639581_at:356:351; Interrogation_Position=1880; Antisense; GCAGATTGCCCGCTGCAATGAGAAC
>probe:Drosophila_2:1639581_at:437:383; Interrogation_Position=1901; Antisense; GAACGTGATCACTTTGCTTGCGAAT
>probe:Drosophila_2:1639581_at:278:253; Interrogation_Position=1935; Antisense; CAAGAACACTTGATGCTGGCGCAGC
>probe:Drosophila_2:1639581_at:651:287; Interrogation_Position=1950; Antisense; CTGGCGCAGCACATCTTTGGAATCA
>probe:Drosophila_2:1639581_at:45:691; Interrogation_Position=1965; Antisense; TTTGGAATCAGTCAGCCCGTGGAGA
>probe:Drosophila_2:1639581_at:261:695; Interrogation_Position=2041; Antisense; TTTCCAGCTATCTTACACATTGTGT
>probe:Drosophila_2:1639581_at:494:675; Interrogation_Position=2109; Antisense; TAGACTGGTGTATTTCGCTTATCGA

Paste this into a BLAST search page for me
GAGGAACTCTCGCACATTTGGAACTGCACATTTGGAACTCCCAGCAGGAGAACTTTGAGTTGACCAGCTCGCCAAAAATTCGAGTGGCACACCTACTGCGACCTACTGCGACCACTGTAGCTGGTGTAGCTGGTGGTTCCCAAAGCCGAAAAGCCGAAGAATTGGCACCCGTGGAGCAGATTGCCCGCTGCAATGAGAACGAACGTGATCACTTTGCTTGCGAATCAAGAACACTTGATGCTGGCGCAGCCTGGCGCAGCACATCTTTGGAATCATTTGGAATCAGTCAGCCCGTGGAGATTTCCAGCTATCTTACACATTGTGTTAGACTGGTGTATTTCGCTTATCGA

Full Affymetrix probeset data:

Annotations for 1639581_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720