Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639582_at:

>probe:Drosophila_2:1639582_at:704:249; Interrogation_Position=4529; Antisense; CAATCTGGTGTGTTCCTAGAAACTC
>probe:Drosophila_2:1639582_at:537:455; Interrogation_Position=4586; Antisense; GATAACTCTTAAACCACATATGTGA
>probe:Drosophila_2:1639582_at:239:191; Interrogation_Position=4644; Antisense; AACTTGTATTGGTCATAACTCTTCA
>probe:Drosophila_2:1639582_at:380:649; Interrogation_Position=4666; Antisense; TCAAAAGGTTTTCTAGACAAGTCCG
>probe:Drosophila_2:1639582_at:446:157; Interrogation_Position=4682; Antisense; ACAAGTCCGTTGTGGCGAGATTTCT
>probe:Drosophila_2:1639582_at:26:429; Interrogation_Position=4698; Antisense; GAGATTTCTGGATCACATTAGCATA
>probe:Drosophila_2:1639582_at:107:473; Interrogation_Position=4740; Antisense; GTTCTGAACACCTCATCTAAATCGC
>probe:Drosophila_2:1639582_at:401:165; Interrogation_Position=4758; Antisense; AAATCGCAAAACACATTACCGCCCA
>probe:Drosophila_2:1639582_at:179:685; Interrogation_Position=4796; Antisense; TATAACATCCATTTTGAGCAACAGT
>probe:Drosophila_2:1639582_at:269:723; Interrogation_Position=4809; Antisense; TTGAGCAACAGTATCGGAGAGCAGT
>probe:Drosophila_2:1639582_at:661:355; Interrogation_Position=4877; Antisense; GCACAGCAATTTGATAGCCTACAAC
>probe:Drosophila_2:1639582_at:257:483; Interrogation_Position=4961; Antisense; GTATATTCTGATCTGTGTGTGTTTG
>probe:Drosophila_2:1639582_at:577:699; Interrogation_Position=4996; Antisense; TTTTAGTTCGTATCGTCAGCGTTAG
>probe:Drosophila_2:1639582_at:363:643; Interrogation_Position=5049; Antisense; TCTAGATGTTTAAGCACCAACCAAC

Paste this into a BLAST search page for me
CAATCTGGTGTGTTCCTAGAAACTCGATAACTCTTAAACCACATATGTGAAACTTGTATTGGTCATAACTCTTCATCAAAAGGTTTTCTAGACAAGTCCGACAAGTCCGTTGTGGCGAGATTTCTGAGATTTCTGGATCACATTAGCATAGTTCTGAACACCTCATCTAAATCGCAAATCGCAAAACACATTACCGCCCATATAACATCCATTTTGAGCAACAGTTTGAGCAACAGTATCGGAGAGCAGTGCACAGCAATTTGATAGCCTACAACGTATATTCTGATCTGTGTGTGTTTGTTTTAGTTCGTATCGTCAGCGTTAGTCTAGATGTTTAAGCACCAACCAAC

Full Affymetrix probeset data:

Annotations for 1639582_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime