FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639584_at:

>probe:Drosophila_2:1639584_at:20:573; Interrogation_Position=1086; Antisense; GGCTCGGCTGGATCAGATGCATTAT
>probe:Drosophila_2:1639584_at:199:599; Interrogation_Position=1152; Antisense; TGTCCCACTGATTGCTCGAACAAAC
>probe:Drosophila_2:1639584_at:188:141; Interrogation_Position=1222; Antisense; ACGGTGATCATGTGCCTCATTGCCA
>probe:Drosophila_2:1639584_at:690:89; Interrogation_Position=1262; Antisense; AGTACTTCGACGATCCATGCACATT
>probe:Drosophila_2:1639584_at:76:357; Interrogation_Position=1280; Antisense; GCACATTCCGGCCAGAGAGATTCGA
>probe:Drosophila_2:1639584_at:69:175; Interrogation_Position=1317; Antisense; AAACGTGGGCATCGAGGCTTTCAAG
>probe:Drosophila_2:1639584_at:61:121; Interrogation_Position=1342; Antisense; AGCGTTCCATTTAGTGCAGGTCCAA
>probe:Drosophila_2:1639584_at:169:423; Interrogation_Position=1381; Antisense; GAGAAGTTCGCCATGTACCAGATGA
>probe:Drosophila_2:1639584_at:289:99; Interrogation_Position=1400; Antisense; AGATGAAGGCTTTGCTGTCCCAATT
>probe:Drosophila_2:1639584_at:53:723; Interrogation_Position=1423; Antisense; TTGCTGCGCCGCTTTGAAATTCTGC
>probe:Drosophila_2:1639584_at:373:395; Interrogation_Position=1438; Antisense; GAAATTCTGCCTGCCGTGGATGGAC
>probe:Drosophila_2:1639584_at:456:579; Interrogation_Position=1454; Antisense; TGGATGGACTTCCTCCGGGAATTAA
>probe:Drosophila_2:1639584_at:417:245; Interrogation_Position=1473; Antisense; AATTAACGACCATTCCCGCGAGGAT
>probe:Drosophila_2:1639584_at:368:417; Interrogation_Position=1509; Antisense; GAGCGAGTACGATCCTGTGTTGAAT

Paste this into a BLAST search page for me
GGCTCGGCTGGATCAGATGCATTATTGTCCCACTGATTGCTCGAACAAACACGGTGATCATGTGCCTCATTGCCAAGTACTTCGACGATCCATGCACATTGCACATTCCGGCCAGAGAGATTCGAAAACGTGGGCATCGAGGCTTTCAAGAGCGTTCCATTTAGTGCAGGTCCAAGAGAAGTTCGCCATGTACCAGATGAAGATGAAGGCTTTGCTGTCCCAATTTTGCTGCGCCGCTTTGAAATTCTGCGAAATTCTGCCTGCCGTGGATGGACTGGATGGACTTCCTCCGGGAATTAAAATTAACGACCATTCCCGCGAGGATGAGCGAGTACGATCCTGTGTTGAAT

Full Affymetrix probeset data:

Annotations for 1639584_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720