FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639586_at:

>probe:Drosophila_2:1639586_at:485:711; Interrogation_Position=1233; Antisense; TTCGTCCCCACTTCTAAAAGCAGTG
>probe:Drosophila_2:1639586_at:256:595; Interrogation_Position=1256; Antisense; TGGGCATCACACTGTCGCGTCAAAA
>probe:Drosophila_2:1639586_at:242:717; Interrogation_Position=1334; Antisense; TTCCGTTGGAGAGCGAGTTCGTTCT
>probe:Drosophila_2:1639586_at:710:93; Interrogation_Position=1349; Antisense; AGTTCGTTCTGAACCAGCGCGATGA
>probe:Drosophila_2:1639586_at:207:73; Interrogation_Position=1391; Antisense; AGGACGTGCAACTGTCCACCGAGGA
>probe:Drosophila_2:1639586_at:316:131; Interrogation_Position=1408; Antisense; ACCGAGGAGCCCAAGTTTATTGTCT
>probe:Drosophila_2:1639586_at:166:187; Interrogation_Position=1444; Antisense; AACAAGGTGCTTTTGCGGCTACAGT
>probe:Drosophila_2:1639586_at:710:571; Interrogation_Position=1460; Antisense; GGCTACAGTTTACCCCAGCAGAGGA
>probe:Drosophila_2:1639586_at:361:597; Interrogation_Position=1487; Antisense; TGTCCGGATTAGCAGACGTCGTTCT
>probe:Drosophila_2:1639586_at:212:501; Interrogation_Position=1504; Antisense; GTCGTTCTGGGCTTCTATATGCAGT
>probe:Drosophila_2:1639586_at:59:63; Interrogation_Position=1583; Antisense; ATGTGCTCCACTCCAGGGTGTTTAT
>probe:Drosophila_2:1639586_at:62:705; Interrogation_Position=1604; Antisense; TTATCACGGCGGGAGCAACTGAGCA
>probe:Drosophila_2:1639586_at:370:153; Interrogation_Position=1661; Antisense; ACAGGCGTACTAATCGACTTATGCG
>probe:Drosophila_2:1639586_at:548:235; Interrogation_Position=1736; Antisense; AATCCGTTCGTGAAACAGCAGCTAG

Paste this into a BLAST search page for me
TTCGTCCCCACTTCTAAAAGCAGTGTGGGCATCACACTGTCGCGTCAAAATTCCGTTGGAGAGCGAGTTCGTTCTAGTTCGTTCTGAACCAGCGCGATGAAGGACGTGCAACTGTCCACCGAGGAACCGAGGAGCCCAAGTTTATTGTCTAACAAGGTGCTTTTGCGGCTACAGTGGCTACAGTTTACCCCAGCAGAGGATGTCCGGATTAGCAGACGTCGTTCTGTCGTTCTGGGCTTCTATATGCAGTATGTGCTCCACTCCAGGGTGTTTATTTATCACGGCGGGAGCAACTGAGCAACAGGCGTACTAATCGACTTATGCGAATCCGTTCGTGAAACAGCAGCTAG

Full Affymetrix probeset data:

Annotations for 1639586_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720