Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639588_at:

>probe:Drosophila_2:1639588_at:606:241; Interrogation_Position=1019; Antisense; AATAGGCCTAATTTATATCGTATAT
>probe:Drosophila_2:1639588_at:22:483; Interrogation_Position=1050; Antisense; GTATTACACATACTCGGACACAAAA
>probe:Drosophila_2:1639588_at:346:559; Interrogation_Position=1065; Antisense; GGACACAAAATTTTGCGAAGCCTAA
>probe:Drosophila_2:1639588_at:347:323; Interrogation_Position=1079; Antisense; GCGAAGCCTAAGCATTGTAATTAAC
>probe:Drosophila_2:1639588_at:446:359; Interrogation_Position=1110; Antisense; GCAACTATTTATGGAGACGGACGAT
>probe:Drosophila_2:1639588_at:159:141; Interrogation_Position=1126; Antisense; ACGGACGATGTGTGCGAGAGTTTAT
>probe:Drosophila_2:1639588_at:113:623; Interrogation_Position=1138; Antisense; TGCGAGAGTTTATTTTTCGTTTACA
>probe:Drosophila_2:1639588_at:665:617; Interrogation_Position=1189; Antisense; TCTGTTAACAAACAACATCGGCTAG
>probe:Drosophila_2:1639588_at:354:271; Interrogation_Position=1204; Antisense; CATCGGCTAGTTTGTTTTTGTTTAG
>probe:Drosophila_2:1639588_at:538:339; Interrogation_Position=1219; Antisense; TTTTGTTTAGGAGAAGCGCCTACGA
>probe:Drosophila_2:1639588_at:469:471; Interrogation_Position=1408; Antisense; GTTCTATTTGAAAACTGCGAAAGCG
>probe:Drosophila_2:1639588_at:567:205; Interrogation_Position=1428; Antisense; AAGCGAAAGACATTAGTGGCCGACA
>probe:Drosophila_2:1639588_at:561:581; Interrogation_Position=1444; Antisense; TGGCCGACAGCACTATCAACAGGAT
>probe:Drosophila_2:1639588_at:433:383; Interrogation_Position=1533; Antisense; GAACGGCAACAAACTCATAATGTAG

Paste this into a BLAST search page for me
AATAGGCCTAATTTATATCGTATATGTATTACACATACTCGGACACAAAAGGACACAAAATTTTGCGAAGCCTAAGCGAAGCCTAAGCATTGTAATTAACGCAACTATTTATGGAGACGGACGATACGGACGATGTGTGCGAGAGTTTATTGCGAGAGTTTATTTTTCGTTTACATCTGTTAACAAACAACATCGGCTAGCATCGGCTAGTTTGTTTTTGTTTAGTTTTGTTTAGGAGAAGCGCCTACGAGTTCTATTTGAAAACTGCGAAAGCGAAGCGAAAGACATTAGTGGCCGACATGGCCGACAGCACTATCAACAGGATGAACGGCAACAAACTCATAATGTAG

Full Affymetrix probeset data:

Annotations for 1639588_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime