Flyatlas logo

FlyAtlas: the Drosophila gene expression atlas

University of Glasgow
Biotechnology & Biological Sciences Research Council
Home & Search
Batch/table Search
Tissues Search
BLASTP Search
About & FAQ
Top 50
Original data
Interesting meta-analysis
Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.


This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639589_at:

>probe:Drosophila_2:1639589_at:249:55; Interrogation_Position=1037; Antisense; ATGAAGTTTTACTGCCCAACATGAA
>probe:Drosophila_2:1639589_at:495:313; Interrogation_Position=1114; Antisense; GCCTTAAACTGACTTCTTCGGCAAG
>probe:Drosophila_2:1639589_at:468:1; Interrogation_Position=1160; Antisense; ATAGGAGTCCACGTGCTCGGGAAAT
>probe:Drosophila_2:1639589_at:348:395; Interrogation_Position=1180; Antisense; GAAATTCCCATAAAGTTGTGTGCGC
>probe:Drosophila_2:1639589_at:526:467; Interrogation_Position=1194; Antisense; GTTGTGTGCGCAATGAGCTGGCTTC
>probe:Drosophila_2:1639589_at:78:121; Interrogation_Position=1209; Antisense; AGCTGGCTTCTTTCAGTCGAGTGAG
>probe:Drosophila_2:1639589_at:725:501; Interrogation_Position=1224; Antisense; GTCGAGTGAGCAATGTTACCTATAA
>probe:Drosophila_2:1639589_at:270:3; Interrogation_Position=710; Antisense; ATTGCCAAGGATCTCGCGAAAATCG
>probe:Drosophila_2:1639589_at:413:587; Interrogation_Position=803; Antisense; TGGAGCCTGGCTACTATTTTGTATT
>probe:Drosophila_2:1639589_at:103:15; Interrogation_Position=818; Antisense; ATTTTGTATTACACCACCTTGGCTG
>probe:Drosophila_2:1639589_at:595:593; Interrogation_Position=841; Antisense; TGTGGGATTTTCGTGCGCCTGGTTC
>probe:Drosophila_2:1639589_at:355:699; Interrogation_Position=863; Antisense; TTCTGGTGGTGGACCAAGTTCCGCA
>probe:Drosophila_2:1639589_at:251:121; Interrogation_Position=903; Antisense; AGCGGATCTCCGTTCAGACTTAAAA
>probe:Drosophila_2:1639589_at:618:91; Interrogation_Position=952; Antisense; AGTTACATTCCGATTTTCTCATAGG

Paste this into a BLAST search page for me
ATGAAGTTTTACTGCCCAACATGAAGCCTTAAACTGACTTCTTCGGCAAGATAGGAGTCCACGTGCTCGGGAAATGAAATTCCCATAAAGTTGTGTGCGCGTTGTGTGCGCAATGAGCTGGCTTCAGCTGGCTTCTTTCAGTCGAGTGAGGTCGAGTGAGCAATGTTACCTATAAATTGCCAAGGATCTCGCGAAAATCGTGGAGCCTGGCTACTATTTTGTATTATTTTGTATTACACCACCTTGGCTGTGTGGGATTTTCGTGCGCCTGGTTCTTCTGGTGGTGGACCAAGTTCCGCAAGCGGATCTCCGTTCAGACTTAAAAAGTTACATTCCGATTTTCTCATAGG

Full Affymetrix probeset data:

Annotations for 1639589_at in Drosophila_2.na32.annot.csv


Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720

measure downtime