FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639590_at:

>probe:Drosophila_2:1639590_at:725:277; Interrogation_Position=3741; Antisense; CTATTCAAGCCTTTCCAAGCGTGGA
>probe:Drosophila_2:1639590_at:623:305; Interrogation_Position=3783; Antisense; CCTGCTGTCGATTGGTGCTGTTAAC
>probe:Drosophila_2:1639590_at:185:5; Interrogation_Position=3808; Antisense; ATAGACATTCCGCAACATCCGGTGG
>probe:Drosophila_2:1639590_at:239:47; Interrogation_Position=3824; Antisense; ATCCGGTGGCCCTACATGGAATGAT
>probe:Drosophila_2:1639590_at:80:379; Interrogation_Position=3854; Antisense; GAAGCTCTAAGCAGTTGTCGTCCAC
>probe:Drosophila_2:1639590_at:318:505; Interrogation_Position=3873; Antisense; GTCCACTCTACAGGAGCTGCGTGTA
>probe:Drosophila_2:1639590_at:367:661; Interrogation_Position=3896; Antisense; TAAAGCGTAACTCTGGTCGGTCCAC
>probe:Drosophila_2:1639590_at:719:445; Interrogation_Position=3921; Antisense; GATGCGTTCGCATACCGCCGAGGAG
>probe:Drosophila_2:1639590_at:217:111; Interrogation_Position=4121; Antisense; AGAATGGATTGCTTCAGCCCCTGGT
>probe:Drosophila_2:1639590_at:41:125; Interrogation_Position=4136; Antisense; AGCCCCTGGTCATGCAGTTCAATGT
>probe:Drosophila_2:1639590_at:610:229; Interrogation_Position=4156; Antisense; AATGTGCTCTTGCAGAGTCTGTCCA
>probe:Drosophila_2:1639590_at:540:431; Interrogation_Position=4170; Antisense; GAGTCTGTCCATCAATGCTGCGCTA
>probe:Drosophila_2:1639590_at:182:349; Interrogation_Position=4206; Antisense; GCAGGCCCAGTATCGCATGAATCAT
>probe:Drosophila_2:1639590_at:296:355; Interrogation_Position=4261; Antisense; GCAAAGTTTGTTATCGACCTACCCA

Paste this into a BLAST search page for me
CTATTCAAGCCTTTCCAAGCGTGGACCTGCTGTCGATTGGTGCTGTTAACATAGACATTCCGCAACATCCGGTGGATCCGGTGGCCCTACATGGAATGATGAAGCTCTAAGCAGTTGTCGTCCACGTCCACTCTACAGGAGCTGCGTGTATAAAGCGTAACTCTGGTCGGTCCACGATGCGTTCGCATACCGCCGAGGAGAGAATGGATTGCTTCAGCCCCTGGTAGCCCCTGGTCATGCAGTTCAATGTAATGTGCTCTTGCAGAGTCTGTCCAGAGTCTGTCCATCAATGCTGCGCTAGCAGGCCCAGTATCGCATGAATCATGCAAAGTTTGTTATCGACCTACCCA

Full Affymetrix probeset data:

Annotations for 1639590_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720