FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639591_at:

>probe:Drosophila_2:1639591_at:239:55; Interrogation_Position=13; Antisense; ATGCAACCGCGAATCGACGACAGCT
>probe:Drosophila_2:1639591_at:551:77; Interrogation_Position=189; Antisense; AGGTCCTGGATTGCTGATTTTTCCC
>probe:Drosophila_2:1639591_at:524:567; Interrogation_Position=214; Antisense; GGCACCGGTCAAAGACATCAGCATA
>probe:Drosophila_2:1639591_at:75:657; Interrogation_Position=237; Antisense; TAATCCAAATGGCAGCACGGGCAGC
>probe:Drosophila_2:1639591_at:695:381; Interrogation_Position=288; Antisense; GAACGCGGCCATTAATCAGCCAGGA
>probe:Drosophila_2:1639591_at:136:207; Interrogation_Position=415; Antisense; AAGCGAAAGGATTGCCGTCCTGCCT
>probe:Drosophila_2:1639591_at:692:625; Interrogation_Position=427; Antisense; TGCCGTCCTGCCTGTTTGGTTAAAG
>probe:Drosophila_2:1639591_at:78:81; Interrogation_Position=450; Antisense; AGGGCAGGCCTTCATAATCGAGTTC
>probe:Drosophila_2:1639591_at:255:33; Interrogation_Position=463; Antisense; ATAATCGAGTTCCTGCAGGGCTCCT
>probe:Drosophila_2:1639591_at:425:81; Interrogation_Position=479; Antisense; AGGGCTCCTCCATACACGGATTCAT
>probe:Drosophila_2:1639591_at:34:291; Interrogation_Position=495; Antisense; CGGATTCATTTATTTGGCCAAGCTC
>probe:Drosophila_2:1639591_at:655:205; Interrogation_Position=514; Antisense; AAGCTCGGCCTGAGTTTCGTCGAAC
>probe:Drosophila_2:1639591_at:178:399; Interrogation_Position=57; Antisense; GACACTGACATCCTCGTCGAGCAGG
>probe:Drosophila_2:1639591_at:90:109; Interrogation_Position=95; Antisense; AGAACGAAGGATCCGCATCCGGCAG

Paste this into a BLAST search page for me
ATGCAACCGCGAATCGACGACAGCTAGGTCCTGGATTGCTGATTTTTCCCGGCACCGGTCAAAGACATCAGCATATAATCCAAATGGCAGCACGGGCAGCGAACGCGGCCATTAATCAGCCAGGAAAGCGAAAGGATTGCCGTCCTGCCTTGCCGTCCTGCCTGTTTGGTTAAAGAGGGCAGGCCTTCATAATCGAGTTCATAATCGAGTTCCTGCAGGGCTCCTAGGGCTCCTCCATACACGGATTCATCGGATTCATTTATTTGGCCAAGCTCAAGCTCGGCCTGAGTTTCGTCGAACGACACTGACATCCTCGTCGAGCAGGAGAACGAAGGATCCGCATCCGGCAG

Full Affymetrix probeset data:

Annotations for 1639591_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720