FlyAtlas: the Drosophila gene expression atlas

Biotechnology & Biological Sciences Research Council

Home & Search

Batch/table Search

Tissues Search

BLASTP Search

About & FAQ

Top 50

Original data

Interesting meta-analysis

Links

Latest news: FlyAtlas2 : A Database web-app for fruitfly expression with added RNA & miRNA goodness ! Click here to visit the application. Read all about it here.

This dataset was generated by Venkat Chintapalli, Jing Wang & Julian Dow at the University of Glasgow with funding from the UK's BBSRC.
It gives you a quick answer to the question: where is my gene of interest expressed/enriched in the adult fly?
For each gene & tissue, you're given the mRNA SIGNAL (how abundant the mRNA is), the mRNA ENRICHMENT (compared to whole flies), and the Affymetrix PRESENT CALL (out of 4 arrays, how many times it was detectably expressed).

looking for 1639592_at:

>probe:Drosophila_2:1639592_at:191:643; Interrogation_Position=1007; Antisense; TCTCCACTCTTCTCACAGGAAATGA
>probe:Drosophila_2:1639592_at:724:31; Interrogation_Position=562; Antisense; ATCAACAAGACCCTCAGTGTGACGG
>probe:Drosophila_2:1639592_at:696:631; Interrogation_Position=590; Antisense; TCCGTGGCGAGGATGTGGTTCTCAA
>probe:Drosophila_2:1639592_at:292:363; Interrogation_Position=629; Antisense; GCAATTTGCACAGCTCAGACGTGGT
>probe:Drosophila_2:1639592_at:354:591; Interrogation_Position=653; Antisense; TGGTCTTGTGGTACTTCGGCGATAA
>probe:Drosophila_2:1639592_at:5:669; Interrogation_Position=664; Antisense; TACTTCGGCGATAATGTCATTTCCA
>probe:Drosophila_2:1639592_at:598:67; Interrogation_Position=689; Antisense; ATGGCAAGAACCTGGTGCAGCCCAA
>probe:Drosophila_2:1639592_at:20:511; Interrogation_Position=703; Antisense; GTGCAGCCCAACTTCAAACTGGACG
>probe:Drosophila_2:1639592_at:221:193; Interrogation_Position=730; Antisense; AACTACGACCTGACCATCCTGAAGG
>probe:Drosophila_2:1639592_at:165:81; Interrogation_Position=764; Antisense; AGGTGGCTGGCAGCTATCTCTGCAA
>probe:Drosophila_2:1639592_at:640:135; Interrogation_Position=817; Antisense; ACGAAGGTGACCATCGCCGAGCATT
>probe:Drosophila_2:1639592_at:501:39; Interrogation_Position=885; Antisense; ATCTGCGAGCAGTTTTCTGGGATGC
>probe:Drosophila_2:1639592_at:1:703; Interrogation_Position=897; Antisense; TTTTCTGGGATGCACTGTCCTGGCA
>probe:Drosophila_2:1639592_at:24:549; Interrogation_Position=944; Antisense; GGATGGGCGCACATTAGATTAGTTT

Paste this into a BLAST search page for me
TCTCCACTCTTCTCACAGGAAATGAATCAACAAGACCCTCAGTGTGACGGTCCGTGGCGAGGATGTGGTTCTCAAGCAATTTGCACAGCTCAGACGTGGTTGGTCTTGTGGTACTTCGGCGATAATACTTCGGCGATAATGTCATTTCCAATGGCAAGAACCTGGTGCAGCCCAAGTGCAGCCCAACTTCAAACTGGACGAACTACGACCTGACCATCCTGAAGGAGGTGGCTGGCAGCTATCTCTGCAAACGAAGGTGACCATCGCCGAGCATTATCTGCGAGCAGTTTTCTGGGATGCTTTTCTGGGATGCACTGTCCTGGCAGGATGGGCGCACATTAGATTAGTTT

Full Affymetrix probeset data:

Annotations for 1639592_at in Drosophila_2.na32.annot.csv

Chintapalli, V. R., Wang, J. and Dow, J. A. T. (2007). Using FlyAtlas to identify better Drosophila models of human disease. Nature Genetics 39: 715-720